Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6946

Pphln1 periphilin 1 ( MGI:1917029)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6946 EMAGE:6946 EMAGE:6946 EMAGE:6946 EMAGE:6946
"Pseudo-wholemount" of euxassay_002435. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002435_01 euxassay_002435_02 euxassay_002435_03 euxassay_002435_04
EMAGE:6946 EMAGE:6946 EMAGE:6946 EMAGE:6946 EMAGE:6946
euxassay_002435_05 euxassay_002435_06 euxassay_002435_07 euxassay_002435_08 euxassay_002435_09
EMAGE:6946 EMAGE:6946 EMAGE:6946 EMAGE:6946 EMAGE:6946
euxassay_002435_10 euxassay_002435_11 euxassay_002435_12 euxassay_002435_13 euxassay_002435_14
EMAGE:6946 EMAGE:6946 EMAGE:6946 EMAGE:6946 EMAGE:6946
euxassay_002435_15 euxassay_002435_16 euxassay_002435_17 euxassay_002435_18 euxassay_002435_19
EMAGE:6946 EMAGE:6946 EMAGE:6946 EMAGE:6946 EMAGE:6946
euxassay_002435_20 euxassay_002435_21 euxassay_002435_22 euxassay_002435_23 euxassay_002435_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6946Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6946_wholemount_strong.wlz
6946_wholemount_moderate.wlz
6946_wholemount_weak.wlz
6946_wholemount_possible.wlz
6946_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6946_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 18 19 20 21 22 23 24 moderate expression: see section 16 17
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 06 07 20 moderate expression: see section 08 09 10 11 13 15 16 17 18 19
4th ventricle lateral recess
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1951
Entity Detected:Pphln1, periphilin 1 ( MGI:1917029)
Sequence:sense strand is shown

>T1951
TGGCCTCGAGCCAGATTCGGACGAGGAAGACGGCCAACCCTGAGAACAACCTGAGCTACTGGAACAATGC
CATCACAATGGACTACTTCAACAGACACGCGGTGGAGCTCCCGAGGGAGATCCAGTCCCTAGAGACCTCA
GAGGACCAGCTCTCAGAGCCCCGCTCCCCAGCCAATGGCGACTATCGAGACACTGGGATGGTCCTCGTGA
ACCCCTTCTGCCAGGAAACACTGTTCGTGGGAAACGACCAAGTTTCCGAGATCTAGATGCAGCAGCCTCC
GCTTTGCCACTCCCTATTTTTGTCTCTAAATTATAAATATACAAATATATATATTATAAATATAACCTTT
GTGTAACCCTGACTTAATAAGAGACATTTTCAGCTTTTTTTCCTAAGAATTGTCAACATCTTTTTTACAA
GTGTGGTTTAAAAAAAAAAAAATTTACAGAATGACCCATGGCTTTATAAAATAAAGGTATTTCTAAGCAA
AAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:639746 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:639746 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6947 same assay
 EMAGE:6952 same embryo
 EMAGE:6951 same embryo
 EMAGE:6950 same embryo
 EMAGE:6949 same embryo
 EurExpress:euxassay_002435 same experiment
 MGI:4828764 same experiment
 EMAGE:6948 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS