Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7142

Kcne1l potassium voltage-gated channel, Isk-related family, member 1-like, pseudogene ( MGI:1913490)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7142 EMAGE:7142 EMAGE:7142 EMAGE:7142 EMAGE:7142
"Pseudo-wholemount" of euxassay_002655. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002655_01 euxassay_002655_02 euxassay_002655_03 euxassay_002655_04
EMAGE:7142 EMAGE:7142 EMAGE:7142 EMAGE:7142 EMAGE:7142
euxassay_002655_05 euxassay_002655_06 euxassay_002655_07 euxassay_002655_08 euxassay_002655_09
EMAGE:7142 EMAGE:7142 EMAGE:7142 EMAGE:7142 EMAGE:7142
euxassay_002655_10 euxassay_002655_11 euxassay_002655_12 euxassay_002655_13 euxassay_002655_14
EMAGE:7142 EMAGE:7142 EMAGE:7142 EMAGE:7142 EMAGE:7142
euxassay_002655_15 euxassay_002655_16 euxassay_002655_17 euxassay_002655_18 euxassay_002655_19
EMAGE:7142 EMAGE:7142 EMAGE:7142 EMAGE:7142
euxassay_002655_20 euxassay_002655_21 euxassay_002655_22 euxassay_002655_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7142Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7142_wholemount_strong.wlz
7142_wholemount_moderate.wlz
7142_wholemount_weak.wlz
7142_wholemount_possible.wlz
7142_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7142_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
head mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 19 20 21 22 23
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 12
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 17
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 10 12 13 14 15 17
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 17 18
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3290
Entity Detected:Kcne1l, potassium voltage-gated channel, Isk-related family, member 1-like, pseudogene ( MGI:1913490)
Sequence:sense strand is shown

>T3290
TGGCCTCGAGCCAGATTCGGACGAGGTGCACCCTGCCTGCTCTGCTTGCTCCCCTTGCTCGCTTGCTTCC
CCTTGTCCAGGGGGAAAGGTCAACTGCGTCCTGGAGCCTCCGTGCCACTCTCCAACAGCTATGAACTGCA
GCGAGAGCCAACGGCTGCAAACCCTCTTGAACCGCTTGCTGCTGGAGCTGCACCATCGTGGCAACGCCAG
CGGCCTGGGCATCGGAACCGGCCCGAGCATGGGCATGGGGGTCGTCCCTGACCCTTTCGTGGGCCGCGAG
GCGACCAGCGCCAAGGGTAACGACGCTTATCTCTACATCCTACTCATCATGATCTTCTATGCCTGCCTAG
CCGGAGGCCTCATCCTGGCCTACACCCGCTCCCGCAAGCTCGTCGAGGCCAAGGATGAGCCACCCCTGGC
CTGTGTTGCTGAGCAGGAATGGGTCCCCGCTGCCATCGCATCTGCCGACCCGGAGAATGGCCAGGGCTTG
CTGGCTGAGGGCGGCCACCAGCTCGCAGCAGGGGCGCTGCCTGCGCTGG
Notes:The probe template was PCR amplified from IMAGE:2780405 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2780405 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7140 same embryo
 EMAGE:7139 same embryo
 EMAGE:7141 same embryo
 EMAGE:7144 same embryo
 EMAGE:7143 same embryo
 EurExpress:euxassay_002655 same experiment
 MGI:4825706 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS