EMAGE mouse gene expression spatial database

EMAGE:7349

Mrpl30 mitochondrial ribosomal protein L30 ( MGI:1333820)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_004464. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_004464_01	euxassay_004464_02	euxassay_004464_03	euxassay_004464_04

euxassay_004464_05	euxassay_004464_06	euxassay_004464_07	euxassay_004464_08	euxassay_004464_09

euxassay_004464_10	euxassay_004464_11	euxassay_004464_12	euxassay_004464_13	euxassay_004464_14

euxassay_004464_15	euxassay_004464_16	euxassay_004464_17	euxassay_004464_18	euxassay_004464_19

euxassay_004464_20	euxassay_004464_21	euxassay_004464_22	euxassay_004464_23	euxassay_004464_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T6451
Entity Detected:	Mrpl30, mitochondrial ribosomal protein L30 ( MGI:1333820)
Sequence:	sense strand is shown >T6451 AGCGGTCGCCGGTTCCCACTATGTAGCCCTGGCTGGAATGCTGTCCGCTCTGATCACCATTGGTGTTCCC CATCCCTGATCTCCTGGTGGAGCCTCTGAAGAGAGAATTCCCACCCCCATGGCTGGGGTTCTGCGCTCCG CGTTCCAGAGGCCTCCATGCAGACTGCAGACTGTGAAGAAAGGTGCAGAATCTCTCATTGGTACAGAATG GATTCGTCACAAATTTACCAAATCAAGAATTCCAGATAAAGTGTTTCAGCCTAAACCTGAAGATCATGAA AAGTATGGTGGGGACCCCCAGAACCCTCACAAACTGCACATTGTCACAAGAATAAGAAGTACAAAGAGGC GTCCATACTGGGAAAAAGATACCATCAAGATGCTTGGACTACAGAAGGCACACAGCCCTCAAATTCACAA GAACATCCCATCGGTGAATGCAAAGCTGAAAGTGGTTAAACACTTGATACGCATCCAGCCTCTGAAGCTG CCACAGGGACTTCCCACAGAAGAGACCATGTCCAGCACATGCCTCAAGAGCACTGGGGAGTTGGTCGTGC AGTGGCATCTGAAGCCCGTGGAGCAGGAAGCGAAGTCCTGACGCCACACAGCTTCAGCTCACAGATGCAC TTACTAAGGAAACCGTTCTCATTAAAGTGTATGTTCATCCAGTCAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:3585410 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3585410 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:7350 same embryo
	EMAGE:7352 same embryo
	EMAGE:7347 same embryo
	EMAGE:7351 same embryo
	EMAGE:7348 same embryo
	EurExpress:euxassay_004464 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source