Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7889

Shisa7 shisa homolog 7 (Xenopus laevis) ( MGI:3605641)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7889 EMAGE:7889 EMAGE:7889 EMAGE:7889 EMAGE:7889
"Pseudo-wholemount" of euxassay_012823. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012823_01 euxassay_012823_02 euxassay_012823_03 euxassay_012823_04
EMAGE:7889 EMAGE:7889 EMAGE:7889 EMAGE:7889 EMAGE:7889
euxassay_012823_05 euxassay_012823_06 euxassay_012823_07 euxassay_012823_08 euxassay_012823_09
EMAGE:7889 EMAGE:7889 EMAGE:7889 EMAGE:7889 EMAGE:7889
euxassay_012823_10 euxassay_012823_11 euxassay_012823_12 euxassay_012823_13 euxassay_012823_14
EMAGE:7889 EMAGE:7889 EMAGE:7889 EMAGE:7889 EMAGE:7889
euxassay_012823_15 euxassay_012823_16 euxassay_012823_17 euxassay_012823_18 euxassay_012823_19
EMAGE:7889 EMAGE:7889 EMAGE:7889 EMAGE:7889 EMAGE:7889
euxassay_012823_20 euxassay_012823_21 euxassay_012823_22 euxassay_012823_23 euxassay_012823_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7889Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7889_wholemount_strong.wlz
7889_wholemount_moderate.wlz
7889_wholemount_weak.wlz
7889_wholemount_possible.wlz
7889_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7889_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 01 02 03 04 16 17 18 19 20 21 22 23 24
diencephalon lateral wall mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 07 08 16 18
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 04 05 06 19 20 22 23 24
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 weak expression: see section 01 02 03 04 05 06 07 08 18 19 20 21 22 23 24
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 15 16 17 weak expression: see section 18 19
medulla oblongata alar plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17 weak expression: see section 07 08
medulla oblongata basal plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17 weak expression: see section 06 07 08
rest of cerebellum mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 04 05 06 07 08 16 17 18 19 20 21
pons mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 06 07 08 16 17 18
midbrain mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 05 06 07 08 16 17 18 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 04 22
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 17 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 03 04 06 07 08 09 17 18 19 20 21 22
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 17 18 19
spinal cord mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 weak expression: see section 08
dorsal root ganglion
weak weak
spottedweak expression: see section 06 07 08 09 13 14 15 16 17
mandible
moderate moderate
regionalmoderate expression: see section 05 06 20 21 weak expression: see section 07 08 09 16 17 18 19
maxilla
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 10 17 18 19
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 04 05 22 23 weak expression: see section 01
tail mesenchyme
weak weak
regionalweak expression: see section 10 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38199
Entity Detected:Shisa7, shisa homolog 7 (Xenopus laevis) ( MGI:3605641)
Sequence:sense strand is shown

>T38199
ATCTGGATGAAGCCTACCTGAAGCGCAGACAACTGGAGATGCCGCGCGGAACGCTGCCCTTGCATGCACT
CCGGCGGCCTGGCACTGGAGGTGGCTACCGTATGGATGGCTGGGGTGGCCCTGAGGAGCTGGGCCTGGCA
CCAGCACCCAACCCACGGCGTGTTATGTCCCAGGAGCACCTTCTGGGTGATGGTAGCCGAGCTTCCCGCT
ATGAGTTCACGTTGCCTCGAGCGCGCCTGGTGTCTCAGGAACACCTGCTGCTGTCCTCACCTGAGGCGCT
TCGCCAGAGTCGCGAGCACCTGCTGTCACCCCCACGAAGTCCTGCACTGCCCCCAGATCCCACCACCCGG
GCCAGCCTGGCTGCCTCACACTCCAACCTGCTGCTAGGGCCTGGGGGCCCCCCCACACCCCTGCATGGGT
TGCCTCCGTCAGGCCTGCATGCCCACCATCACCATGCCCTTCATGGCTCTCCTCAGCCAGCCTGGATGTC
TGATGCGGGCGGGGGTGGGGGCACACTGGCCCGCAGGCCACCCTTCCAGCGCCAGGGCACCCTGGAGCAG
CTGCAGTTCATTCCTGGGCACCACCTGCCCCAGCACCTGCGCACTGCCAGCAAGAACGAAGTGACTGTCT
GAGGCCCGGTGGAGTGCTGGGGGCTGTGGCTTCCGAGGCCCCCTTCTCCCAGCCCAGATCTCCATTACAA
GGCTTATCATACACACCAAGGCTCTGAGACCAGATGGGCCCTTGGACCGGAGACCACGCCTCCTTTTGGG
ATGTTACAGTAGATGAGATCTCTCCTTTTACTTTGTCACTGTTTGAACCAAGGCCTCCCTCCCATGATGT
CATCCCAGAGGAAGGAGGCCTGTATATGAGGTCATTGCTAGCAAATATGTCTGTGTTTTATGATGTTGTT
TGCAGGGACTAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 105107. Forward Primer - name:105107_F_cDNA_D430041B17, sequence:ATCTGGATGAAGCCTACCTGAA; Reverse Primer - name:105107_N_SP6_cDNA_D430041B17, sequence:TTAGTCCCTGCAAACAACATC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7888 same embryo
 EMAGE:7892 same embryo
 EMAGE:7890 same embryo
 EMAGE:7891 same embryo
 EurExpress:euxassay_012823 same experiment
 MGI:4828060 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS