Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8073

Mcc mutated in colorectal cancers ( MGI:96930)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8073 EMAGE:8073 EMAGE:8073 EMAGE:8073 EMAGE:8073
"Pseudo-wholemount" of euxassay_016045. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016045_01 euxassay_016045_02 euxassay_016045_03 euxassay_016045_04
EMAGE:8073 EMAGE:8073 EMAGE:8073 EMAGE:8073 EMAGE:8073
euxassay_016045_05 euxassay_016045_06 euxassay_016045_07 euxassay_016045_08 euxassay_016045_09
EMAGE:8073 EMAGE:8073 EMAGE:8073 EMAGE:8073 EMAGE:8073
euxassay_016045_10 euxassay_016045_11 euxassay_016045_12 euxassay_016045_13 euxassay_016045_14
EMAGE:8073 EMAGE:8073 EMAGE:8073 EMAGE:8073 EMAGE:8073
euxassay_016045_15 euxassay_016045_16 euxassay_016045_17 euxassay_016045_18 euxassay_016045_19
EMAGE:8073 EMAGE:8073 EMAGE:8073 EMAGE:8073
euxassay_016045_20 euxassay_016045_21 euxassay_016045_22 euxassay_016045_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8073Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8073_wholemount_strong.wlz
8073_wholemount_moderate.wlz
8073_wholemount_weak.wlz
8073_wholemount_possible.wlz
8073_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8073_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 05 06 07 15 16 17
pineal primordium
weak weak
regionalweak expression: see section 11
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 06 10 11 15
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 14 15
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
pons mantle layer
weak weak
regionalweak expression: see section 06 16
midbrain mantle layer
weak weak
regionalweak expression: see section 07 14
stomach
weak weak
regionalweak expression: see section 01 02 03 06
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39752
Entity Detected:Mcc, mutated in colorectal cancers ( MGI:96930)
Sequence:sense strand is shown

>T39752
CCTGGAGGAATGTAAAAGCAACGCCGAGAGGATGAGCATGCTGGTGGGGAAGTACGAATCCAACGCCACA
GCCCTGAGGCTGGCCTTGCAGTACAGCGCTGATGCCAGGCTGCACTTCTCTTGCAGTGAGCAGTGCATAG
AAGCCTATGAACTCCTGCTGGCCCTGGCTGAGAGCGAGCAGAGCCTCATCCTGGGGCAATTCCGAGCAGC
TGGTGTGGGCTCCTCCCCTGGAGACCAGTCAGGGGATGAAAATATCACTCAGATGCTCAAGCGGGCTCAT
GACTGCCGGAAGACTGCTGAGAACGCCGCCAAAGCCCTGCTCATGAAGCTGGATGGCAGCTGCGGGGGAG
CCTTCGCCGTGGCTGGCTGCAGCGTGCAGCCCTGGGAGAGCCTGTCCTCCAACAGCCATACCAGCACGAC
CAGCTCTACAGCCAGCAGCTGTGACACAGAGTTCACTAAGGAAGATGAGCAAAGGTTGAAGGATTATATC
CAGCAGCTCAAGAATGACAGAGCCGCCGTCAAGCTGACCATGCTGGAGCTGGAGAGCATCCACATCGATC
CACTCAGCTATGATGTCAAGCCAAGAGGCGACAGCCAGAGGCTGGACCTGGAAAATGCCGTGCTGATGCA
GGAGCTGATGGCCATGAAGGAGGAGATGGCTGAGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 85796. Forward Primer - name:085796_F_cDNA_LOC328949, sequence:CCTGGAGGAATGTAAAAGCAAC; Reverse Primer - name:085796_N_SP6_cDNA_LOC328949, sequence:AGCTCAGCCATCTCCTCCTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8075 same embryo
 EMAGE:8070 same embryo
 EMAGE:8071 same embryo
 EMAGE:8072 same embryo
 EMAGE:8074 same embryo
 EurExpress:euxassay_016045 same experiment
 MGI:4826124 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS