EMAGE mouse gene expression spatial database

EMAGE:8198

Rps24 ribosomal protein S24 ( MGI:98147)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_007446. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_007446_01	euxassay_007446_02	euxassay_007446_03	euxassay_007446_04

euxassay_007446_05	euxassay_007446_06	euxassay_007446_07	euxassay_007446_08	euxassay_007446_09

euxassay_007446_10	euxassay_007446_11	euxassay_007446_12	euxassay_007446_13	euxassay_007446_14

euxassay_007446_15	euxassay_007446_16	euxassay_007446_17	euxassay_007446_18	euxassay_007446_19

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T8099
Entity Detected:	Rps24, ribosomal protein S24 ( MGI:98147)
Sequence:	sense strand is shown >T8099 AAGAGGTAATCCCCAGCTCCGGCGCCGTAGCCATCATGAATGACACAGTAACCATCCGGACCAGGAAGTT CATGACCAACCGTCTGCTTCAGAGGAAACAGATGGTCATTGATGTCCTTCATCCTGGGAAGGCAACAGTA CCGAAGACAGAAATTCGGGAAAAGCTGGCCAAAATGTACAAAACCACACCAGATGTCATCTTTGTATTTG GATTCAGAACCCACTTCGGTGGTGGCAAGACCACTGGCTTTGGCATGATCTATGATTCTTTAGATTATGC AAAGAAGAATGAGCCTAAACACAGACTGGCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCCCGAAAA CAGCGAAAGGAACGCAAGAACAGAATGAAGAAGGTCAGGGGCACGGCGAAGGCCAATGTTGGTGCTGGCA AAAAGAAATGAAATACCTAGCAGTGAGTGGAGATTGGATACAGCCAAAGGAGTAGATCTGCGGTGACTTG ATGTTTTGCTGTGATGTGCAGATTTCTGAGAGGACAAATAAACTAAAAAGCTCCTACAAAAAAAAAAAAA AAAA
Notes:	The probe template was PCR amplified from IMAGE:30058168 using vector (pSPORT1) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:30058168 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:8196 same embryo
	EMAGE:8195 same embryo
	EMAGE:8194 same embryo
	EMAGE:8197 same embryo
	EurExpress:euxassay_007446 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source