Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8308

Npnt nephronectin ( MGI:2148811)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8308 EMAGE:8308 EMAGE:8308 EMAGE:8308 EMAGE:8308
"Pseudo-wholemount" of euxassay_007623. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007623_01 euxassay_007623_02 euxassay_007623_03 euxassay_007623_04
EMAGE:8308 EMAGE:8308 EMAGE:8308 EMAGE:8308 EMAGE:8308
euxassay_007623_05 euxassay_007623_06 euxassay_007623_07 euxassay_007623_08 euxassay_007623_09
EMAGE:8308 EMAGE:8308 EMAGE:8308 EMAGE:8308 EMAGE:8308
euxassay_007623_10 euxassay_007623_11 euxassay_007623_12 euxassay_007623_13 euxassay_007623_14
EMAGE:8308 EMAGE:8308 EMAGE:8308 EMAGE:8308 EMAGE:8308
euxassay_007623_15 euxassay_007623_16 euxassay_007623_17 euxassay_007623_18 euxassay_007623_19
EMAGE:8308 EMAGE:8308 EMAGE:8308 EMAGE:8308 EMAGE:8308
euxassay_007623_20 euxassay_007623_21 euxassay_007623_22 euxassay_007623_23 euxassay_007623_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8308Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8308_wholemount_strong.wlz
8308_wholemount_moderate.wlz
8308_wholemount_weak.wlz
8308_wholemount_possible.wlz
8308_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8308_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 02 03 04 21 22
upper leg muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 20 21 22 23
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 20 21 22 23 24 weak expression: see section 10 11 13 14 15 16 17 18 19
pericardial cavity
moderate moderate
regionalmoderate expression: see section 19 20 weak expression: see section 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18
pleural cavity
moderate moderate
regionalmoderate expression: see section 19 20 weak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 23 24
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 09 19 20 21
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 14 15 19 20 21 22 23 24 moderate expression: see section 07 08 09 10 11 12 13 16 17 18
vibrissa
weak weak
regionalweak expression: see section 06 07 08 21
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 14 moderate expression: see section 10 11 15
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 15 moderate expression: see section 08 09 10 11 13
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 16 17 18 moderate expression: see section 09 10 13 14 15 weak expression: see section 11 12
ventral grey horn
strong strong
single cellstrong expression: see section 10 moderate expression: see section 11 12 13 14
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 15 16 17 18 weak expression: see section 08
nasal septum
strong strong
regionalstrong expression: see section 09 10 17 18 19 moderate expression: see section 11 12 13 15 16
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 weak expression: see section 06
midgut
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17 18
mandible
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 moderate expression: see section 03 04
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 13 15 16
maxilla
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 15 16 17 18 19 20 21
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16
metanephros
strong strong
regionalstrong expression: see section 05 06 07 08 09 15 16 17 18 19
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 10 11 12 13
vault of skull
strong strong
regionalstrong expression: see section 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 20 21 22 23 24
clavicle
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36697
Entity Detected:Npnt, nephronectin ( MGI:2148811)
Sequence:sense strand is shown

>T36697
AACACGTTTGGGAGCTACATCTGCAAGTGTCACACTGGTTTCGACCTCATGTACATTGGAGGCAAATATC
AGTGCCATGACATCGACGAGTGCTCTCTTGGACAGCACCAGTGTAGCAGCTATGCCCGGTGTTACAACAT
ACATGGGTCCTACAAGTGCCAATGTAGAGATGGATACGAGGGGGATGGACTGAACTGTGTGTATATCCCC
AAAGTCATGATTGAACCTTCAGGTCCAATCCATATGCCAGAAAGAAATGGTACAATCTCAAAGGGTGATG
GAGGACATGCGAATAGGATTCCTGATGCTGGAAGTACAAGGTGGCCCCTGAAGACACCATATATTCCTCC
TGTCATTACCAACAGGCCTACTTCCAAGCCAACAACAAGACCTACACCAAACCCAACACCACAGCCTACT
CCACCACCTCCACCACCCCTCCCGACAGAGCCCAGAACAACTCCACTACCACCAACCCCAGAAAGGCCAT
CTACCAGACCCACCACTATAGCACCTGCTACCAGTACCACTACACGAGTAATTACGGTTGACAACAGGAT
ACAGACGGATCCTCAGAAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91989. Forward Primer - name:091989_F_cDNA_Npnt, sequence:AACACGTTTGGGAGCTACATCT; Reverse Primer - name:091989_N_SP6_cDNA_Npnt, sequence:TTTCTGAGGATCCGTCTGTATC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8309 same embryo
 EMAGE:8311 same embryo
 EMAGE:8307 same embryo
 EMAGE:8312 same embryo
 EMAGE:8310 same embryo
 EurExpress:euxassay_007623 same experiment
 MGI:4826766 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS