Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8309

Nmnat2 nicotinamide nucleotide adenylyltransferase 2 ( MGI:2444155)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8309 EMAGE:8309 EMAGE:8309 EMAGE:8309 EMAGE:8309
"Pseudo-wholemount" of euxassay_007621. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007621_01 euxassay_007621_02 euxassay_007621_03 euxassay_007621_04
EMAGE:8309 EMAGE:8309 EMAGE:8309 EMAGE:8309 EMAGE:8309
euxassay_007621_05 euxassay_007621_06 euxassay_007621_07 euxassay_007621_08 euxassay_007621_09
EMAGE:8309 EMAGE:8309 EMAGE:8309 EMAGE:8309 EMAGE:8309
euxassay_007621_10 euxassay_007621_11 euxassay_007621_12 euxassay_007621_13 euxassay_007621_14
EMAGE:8309 EMAGE:8309 EMAGE:8309 EMAGE:8309 EMAGE:8309
euxassay_007621_15 euxassay_007621_16 euxassay_007621_17 euxassay_007621_18 euxassay_007621_19
EMAGE:8309 EMAGE:8309 EMAGE:8309 EMAGE:8309 EMAGE:8309
euxassay_007621_20 euxassay_007621_21 euxassay_007621_22 euxassay_007621_23 euxassay_007621_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8309Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8309_wholemount_strong.wlz
8309_wholemount_moderate.wlz
8309_wholemount_weak.wlz
8309_wholemount_possible.wlz
8309_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8309_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon marginal layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
metencephalon
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain
strong strong
regionalstrong expression: see section 05 06 07 08 14 15 16 17 19
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 08 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 08 17 18 19
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 moderate expression: see section 10 17
spinal cord
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 13 14 15 16 17 18 not examined expression: see section 10
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36691
Entity Detected:Nmnat2, nicotinamide nucleotide adenylyltransferase 2 ( MGI:2444155)
Sequence:sense strand is shown

>T36691
GGATACCCAGCTCTCTGCTCTATTCTCCCCGTGTCCTCTGCCAACACACTGTCAGACCCCGGTTTCTCTC
CTGCCTCTCTGTTTCTCTGTCTTCATCTTGACTGTTCTCCCCACTGGCTGACCTAACCCCCACAGTGTGG
AGGGCCTGCGAAGAACCGTGGCGCACCCCATTCCACAGTCATCTTTGGACAAACTTTCCTCTAGTCTCCG
GGTTGGGGGTGGGTAAGGGAACAGGGTGGGAGTTGGGGAAAGTGCAGCCCTTGGAGATGTACTGGTGTCC
GTATCCCAGCATGCTCTGGGGACATGGCTCAGGCCCTTGCCTTCCCAGCATGCCCTTTACCACAAAGGGC
TATTTTTTTTTCTTTTTCTTTGTCCACTTCTTGTAGAACTTGGATGAAATCAGTGTGTGTGTGAGTGTGT
TTGTTTGTTTGTAGTCTTGATGCTCTCCTGTGGTTTACTTCCCTTCTGATAGGACACTATAGCCAGTCTC
AGCACTCGTAAGTGCGGAGGGCCACATCCAGGAAAGAAGGCAGAGCCTCTCTGCTTTTCCAATACACACA
CACACACACACACACACACACACACACACACACACANCGCACACCAGCAGCAGCATCCCCAGACCCCTTT
GGTCAAGAGTAAGACTTTCAGGTTCTGAAACCTGGTACATAAGTCTGGGAAGAGTAGGGGTTTCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93649. Forward Primer - name:093649_F_cDNA_Nmnat2, sequence:GGATACCCAGCTCTCTGCTCTA; Reverse Primer - name:093649_N_SP6_cDNA_Nmnat2, sequence:GAGAAACCCCTACTCTTCCCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8308 same embryo
 EMAGE:8311 same embryo
 EMAGE:8307 same embryo
 EMAGE:8312 same embryo
 EMAGE:8310 same embryo
 EurExpress:euxassay_007621 same experiment
 MGI:4826734 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS