Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8396

Psme4 proteasome (prosome, macropain) activator subunit 4 ( MGI:2143994)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8396 EMAGE:8396 EMAGE:8396 EMAGE:8396 EMAGE:8396
"Pseudo-wholemount" of euxassay_009612. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009612_01 euxassay_009612_02 euxassay_009612_03 euxassay_009612_04
EMAGE:8396 EMAGE:8396 EMAGE:8396 EMAGE:8396 EMAGE:8396
euxassay_009612_05 euxassay_009612_06 euxassay_009612_07 euxassay_009612_08 euxassay_009612_09
EMAGE:8396 EMAGE:8396 EMAGE:8396 EMAGE:8396 EMAGE:8396
euxassay_009612_10 euxassay_009612_11 euxassay_009612_12 euxassay_009612_13 euxassay_009612_14
EMAGE:8396 EMAGE:8396 EMAGE:8396 EMAGE:8396 EMAGE:8396
euxassay_009612_15 euxassay_009612_16 euxassay_009612_17 euxassay_009612_18 euxassay_009612_19
EMAGE:8396 EMAGE:8396 EMAGE:8396 EMAGE:8396
euxassay_009612_20 euxassay_009612_21 euxassay_009612_22 euxassay_009612_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8396Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8396_wholemount_strong.wlz
8396_wholemount_moderate.wlz
8396_wholemount_weak.wlz
8396_wholemount_possible.wlz
8396_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8396_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 05 06 07 08 16 17 18 19
facial vii ganglion
weak weak
regionalweak expression: see section 03 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 18 19
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 22
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 12 13 14 15 16 17 18 19
neural retina
weak weak
regionalweak expression: see section 01 02 21 22 23
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 06 07 08 09 10 13 14 15 16
mandible
moderate moderate
regionalmoderate expression: see section 02 03 04 16 20 21 22 weak expression: see section 06 07 09 15 17 18 19
maxilla
moderate moderate
regionalmoderate expression: see section 02 03 04 16 weak expression: see section 06 07 15 17 18
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36911
Entity Detected:Psme4, proteasome (prosome, macropain) activator subunit 4 ( MGI:2143994)
Sequence:sense strand is shown

>T36911
AGAGATAAGTTTAGTCCCCGGCGTTCCTGCCTCTTTAAGGGTATATTTAGAAATTTTGATGATGCTTTTC
TGCCTGTTCTGAAGCCCCATTTAGAACGTTTGGTTGCAGATTCTCATGAAAGTACCCAGAGATGTGTTGC
AGAAATTATAGCTGGTTTAATCAGAGGTTCTAAGCATTGGACGTTTGAGAAGGTGGAGAAGCTTTGGGAG
GTCCTGTGCCCGCTGCTGAGAACGGCGCTGTCCAACATGACAGTGGAGACATACAATGACTGGGGGACCT
GTATAGCCACTTCCTGTGAAAGCAGAGATCCCCGGAAGCTTCACTGGCTTTTTGAGCTGCTCTTGGAGTC
ACCATTGAGTGGTGAAGGGGGGTCCTTTGTAGATGCATGCCGACTCTATGTGCTACAAGGTGGCCTTGCC
CAGCAAGAGTGGAGAGTCCCTGAACTATTGCACAGACTTCTGAAGTACTTGGAACCAAAACTCACCCAGG
TTTACAAAAATGTCAGAGAAAGAATAGGAAGTGTGCTGACCTACATATTTATGATAGATGTTTCTTTGCC
AAATACTGCTCCAACAACATCTCCTTGTATCCCTGAGTTTACTGCTCGCGTCCTAGAAAAACTGAAACCA
CTCCCAGATGTGGATGAAGAAATTCAGAACCATGTTATGGAAGAAAATGGCATTGGTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89161. Forward Primer - name:089161_F_cDNA_Psme4, sequence:AGAGATAAGTTTAGTCCCCGGC; Reverse Primer - name:089161_N_SP6_cDNA_Psme4, sequence:TCACCAATGCCATTTTCTTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8395 same embryo
 EMAGE:8398 same embryo
 EMAGE:8397 same embryo
 EMAGE:8394 same embryo
 EMAGE:8393 same embryo
 EurExpress:euxassay_009612 same experiment
 MGI:4827493 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS