Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8565

Ptprs protein tyrosine phosphatase, receptor type, S ( MGI:97815)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8565 EMAGE:8565 EMAGE:8565 EMAGE:8565 EMAGE:8565
"Pseudo-wholemount" of euxassay_009779. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009779_01 euxassay_009779_02 euxassay_009779_03 euxassay_009779_04
EMAGE:8565 EMAGE:8565 EMAGE:8565 EMAGE:8565 EMAGE:8565
euxassay_009779_05 euxassay_009779_06 euxassay_009779_07 euxassay_009779_08 euxassay_009779_09
EMAGE:8565 EMAGE:8565 EMAGE:8565 EMAGE:8565 EMAGE:8565
euxassay_009779_10 euxassay_009779_11 euxassay_009779_12 euxassay_009779_13 euxassay_009779_14
EMAGE:8565 EMAGE:8565 EMAGE:8565 EMAGE:8565 EMAGE:8565
euxassay_009779_15 euxassay_009779_16 euxassay_009779_17 euxassay_009779_18 euxassay_009779_19
EMAGE:8565 EMAGE:8565 EMAGE:8565
euxassay_009779_20 euxassay_009779_21 euxassay_009779_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8565Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8565_wholemount_strong.wlz
8565_wholemount_moderate.wlz
8565_wholemount_weak.wlz
8565_wholemount_possible.wlz
8565_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8565_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 17 moderate expression: see section 02 04 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 17 moderate expression: see section 16
trigeminal v ganglion
strong strong
regionalstrong expression: see section 01 05 06 17 moderate expression: see section 02 03 04 07 16 18 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 06 moderate expression: see section 07 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 17 moderate expression: see section 16
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 09 15 16
spinal cord
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 14 15
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 08 15 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 11 12 13 14 15 16
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 22
nasal cavity olfactory epithelium
strong strong
single cellstrong expression: see section 09 10 11 12 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36926
Entity Detected:Ptprs, protein tyrosine phosphatase, receptor type, S ( MGI:97815)
Sequence:sense strand is shown

>T36926
CCTTCCTCATTCCCTTCTGATTCCAAAACGAGGTTCCAGGGTGGGGGGTTGGGGTGGAGAGAGAAGGAGC
CACTGCTCCCCAGGCTGGGGTCACACAGGGACCGACCTCTGCTTCCGCACTCCCCTGCCTGCCTTTTGGC
AACATTTTTTTTCTTATTTTTTTTTAATAGTGTATATTTTTTTTCTTTTTCTTTTTTTCTTTTTTTTTTT
TAAGAAAAAAACAAAATCGTGCCGGTCAAAACTTTGAAAAAGAAACAAGATCACTGTTTGTGCCTCTGTG
GGAGGCCTATTTTTTCATAGTTAGTGTGCCGTGTGGCGGCTATGTGCGGCCACTTCGACGGCTTCTGTGT
GTGCATCTTTCCCACATGCCCGACACTGCCCCCATCCCCATGTGAATGGTGCGCTTAGTTTTTATTTTTA
ACCTTTTTACTTTTTTTTTAATCAATCTTCAGACATATCAGATATGGAGGGTGAGGCGCTGGGGGCACTC
GGGCCAGACTACAGGGACATGGCCACCAAGGACACAGTGGCTGGCCTTGCTGCTCCCAGTCCCTGGCACA
CCAGGGAGGGTCCTCGTCTACTCATGACCTCTGTGCCCCGCATGGAGGACCTGGGACTACGGGACACTTG
GGGGATATCCAACC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 64185. Forward Primer - name:064185_F_cDNA_Ptprs, sequence:CCTTCCTCATTCCCTTCTGATT; Reverse Primer - name:064185_N_SP6_cDNA_Ptprs, sequence:GGTTGGATATCCCCCAAGTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8570 same embryo
 EMAGE:8567 same embryo
 EMAGE:8566 same embryo
 EMAGE:8569 same embryo
 EMAGE:8568 same embryo
 EurExpress:euxassay_009779 same experiment
 MGI:4827533 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS