Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8848

Wdfy3 WD repeat and FYVE domain containing 3 ( MGI:1096875)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8848 EMAGE:8848 EMAGE:8848 EMAGE:8848 EMAGE:8848
"Pseudo-wholemount" of euxassay_010172. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010172_01 euxassay_010172_02 euxassay_010172_03 euxassay_010172_04
EMAGE:8848 EMAGE:8848 EMAGE:8848 EMAGE:8848 EMAGE:8848
euxassay_010172_05 euxassay_010172_06 euxassay_010172_07 euxassay_010172_08 euxassay_010172_09
EMAGE:8848 EMAGE:8848 EMAGE:8848 EMAGE:8848 EMAGE:8848
euxassay_010172_10 euxassay_010172_11 euxassay_010172_12 euxassay_010172_13 euxassay_010172_14
EMAGE:8848 EMAGE:8848 EMAGE:8848 EMAGE:8848 EMAGE:8848
euxassay_010172_15 euxassay_010172_16 euxassay_010172_17 euxassay_010172_18 euxassay_010172_19
EMAGE:8848 EMAGE:8848 EMAGE:8848 EMAGE:8848
euxassay_010172_20 euxassay_010172_21 euxassay_010172_22 euxassay_010172_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8848Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8848_wholemount_strong.wlz
8848_wholemount_moderate.wlz
8848_wholemount_weak.wlz
8848_wholemount_possible.wlz
8848_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8848_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 21 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 09
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 20
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 19 20 21
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 18 19
cervical ganglion
moderate moderate
regionalmoderate expression: see section 10 18 19
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31823
Entity Detected:Wdfy3, WD repeat and FYVE domain containing 3 ( MGI:1096875)
Sequence:sense strand is shown

>T31823
TTTCAGTGTTGCCCACCCCTGATTGTTTCTTTAGAAGGATGCCGGTGTCCCTCCATTGCAGAAACTGCTT
TTGCACAGTAGGGAGCGGCCCTGCTGCCTCTGGACGCTTTGCAACAGTGTTACTTTACACTTTTGGAAAG
CAGCGCCCTCCTGTGGCCCACGACCCTCATTTCCCCATACCCAATGGCAGAGGTGTTCAAGACTTGAATA
GAGGAATGTGTGTGTAGCCACTTGAAGCTTGCTCCACTGTCTGTCTAACCTGACATGCTGTGGGATGAAC
GCTCTTAAACTTTCCAGCCCATAACTAGTAGATGGAAAGCAAACCCTCGCTCACTATGGCATTTCCTCTG
GCAGCTGGTGCTGTGGGCAACTGTCTTCTTTCCATCAGGTTTTGGTTTTTGTTTTCTTTTCCCTTCTGCA
GAAATCACAGAGACACTCGCACTGGGCACTGGGCTCACATCCCTTGGCTTCATTGCTCATCTGGCTGGCT
GGCCCTCCGTGTTCGTGCCATTCTCCTTACCAATATACACTATGTATATACCTCCTGCGGCCTGCATTCT
TTTTCTAAGTACCTCACAGGGCTCCAGCCTGACCCTCTGTTCACCCCTCGCCCCTCCACCCACTGCTCAT
CCACGTACTCGACACACTCGTGTGTAGCGTGCAAGTGTGATGTCACGCTTTTGAAGACGAGAAGTAGCTG
CCCGTAGCAGCCAGCCCTCTGGAGAATAGCAAAACAAATCTAGATAAGTTATTTTGCACTTTCTTATGTA
TAAAGGTGGTAGAAACTTATTTTTGCTTTGTATCATTTAAATACATTTTGTTTTGGTAAACAGACTGTGT
ATAAACTATTTACGCGGTTGACGCTGTTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6515138), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59445. Forward Primer - name:059445_F_IRAV99_g04_Wdfy3, sequence:TTTCAGTGTTGCCCACCC; Reverse Primer - name:059445_R_SP6_IRAV99_g04_Wdfy3, sequence:AAAAACAGCGTCAACCGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8845 same embryo
 EMAGE:8844 same embryo
 EMAGE:8843 same embryo
 EMAGE:8847 same embryo
 EMAGE:8846 same embryo
 EurExpress:euxassay_010172 same experiment
 MGI:4829190 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS