Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8853

Rps6ka2 ribosomal protein S6 kinase, polypeptide 2 ( MGI:1342290)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8853 EMAGE:8853 EMAGE:8853 EMAGE:8853 EMAGE:8853
"Pseudo-wholemount" of euxassay_010093. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010093_01 euxassay_010093_02 euxassay_010093_03 euxassay_010093_04
EMAGE:8853 EMAGE:8853 EMAGE:8853 EMAGE:8853 EMAGE:8853
euxassay_010093_05 euxassay_010093_06 euxassay_010093_07 euxassay_010093_08 euxassay_010093_09
EMAGE:8853 EMAGE:8853 EMAGE:8853 EMAGE:8853 EMAGE:8853
euxassay_010093_10 euxassay_010093_11 euxassay_010093_12 euxassay_010093_13 euxassay_010093_14
EMAGE:8853 EMAGE:8853 EMAGE:8853 EMAGE:8853 EMAGE:8853
euxassay_010093_15 euxassay_010093_16 euxassay_010093_17 euxassay_010093_18 euxassay_010093_19
EMAGE:8853 EMAGE:8853 EMAGE:8853 EMAGE:8853 EMAGE:8853
euxassay_010093_20 euxassay_010093_21 euxassay_010093_22 euxassay_010093_23 euxassay_010093_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8853Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8853_wholemount_strong.wlz
8853_wholemount_moderate.wlz
8853_wholemount_weak.wlz
8853_wholemount_possible.wlz
8853_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8853_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
weak weak
regionalweak expression: see section 04 06 21 22
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 19 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 09 18
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 18 19 20
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 09 10 16 17
cervical ganglion
weak weak
regionalweak expression: see section 10 17
thoracic ganglion
weak weak
regionalweak expression: see section 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 16 17 18 weak expression: see section 07 08 09 10 12 13 14 15 19
neural retina
weak weak
regionalweak expression: see section 01 02 03 22 23 24
renal cortex
weak weak
regionalweak expression: see section 05 06 07 08 09 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32119
Entity Detected:Rps6ka2, ribosomal protein S6 kinase, polypeptide 2 ( MGI:1342290)
Sequence:sense strand is shown

>T32119
GACCCTCAGCAACGCCTAACAGCAGTTCAAGTGTTGAAGCACCCGTGGATCGTGAACAGAGAGTACCTAT
CCCAAAACCAGCTGAGCAGACAGGATGTCCATCTAGTGAAGGGTGCCATGGCGGCCACCTACTTTGCTCT
GAACAGGACCCCACAGGCACCGAGGCTAGAGCCTGTGCTCTCATCTAGCTTGGCCCAACGCAGAGGCATG
AAGAGACTCACGTCTACCAGGTTGTAGTGGCCAGCCAAGTCTCCAGCCTCAGTCGCCCTGCCCAACGTCC
TCTCAGCCTCACAGACACCAGACATAGGTCCTGTTCATGGGCACTTGAGTGCCCATGAGTCCAGCACAAA
GATGGATCTGGCCTTGGCTGTCTCTCTGTTTCCTTTGCAGCCCTGGAAAGGGTCCTGCCCAGGATGTCTG
AGCCTTGCTGCACCGACCTCGCCGCCCGCTCTCTCTCCTCCTGAGTGAAACCAAATGAATCTGTCACCTC
ATAGCACCCTGCTGGGGCCTCCCTGGGCTCACTCAGGGCTCTCAGTGTCTCCATGTCATGGCTTATGCCC
AAAGCAGAGCTCTTTTACCATCCTGATGTCACCTACGTGTCCCACTGTCTCTCTGAGAGTGTTAGTGCAC
AGTCCCTGCCTGGAGACAGCAGAGCCACAGCAGAGCTGGATGTTCCTGGATGTTCTGGCAATGCCAGTGG
CCATGTGAAAGCATCCAGCTTAGATGCCTGGCTCTGTCCACAATCACCCAAAGAGTGCTCCTCACCACCC
TCCTGCTCTCAAGCAAGATGCTGGGTAGCCTCTCCCTGACTCTGTCTCTGACTTGGCAGGATGAAAGCAA
CCAACCCAAGAGTCTAGATGGCTAGAGTCTATTTGAGAGCGTGATTCCTGTTGGTTGAGACAGGAGCCCC
AGGAAATT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6491001), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58431. Forward Primer - name:058431_F_IRAV93_d05_Rps6ka2, sequence:GACCCTCAGCAACGCCTA; Reverse Primer - name:058431_R_SP6_IRAV93_d05_Rps6ka2, sequence:CAATTTCCTGGGGCTCCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8849 same embryo
 EMAGE:8852 same embryo
 EMAGE:8854 same embryo
 EMAGE:8851 same embryo
 EMAGE:8850 same embryo
 EurExpress:euxassay_010093 same experiment
 MGI:4827809 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS