Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8929

Hist1h1t histone cluster 1, H1t ( MGI:1888530)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8929 EMAGE:8929 EMAGE:8929 EMAGE:8929 EMAGE:8929
"Pseudo-wholemount" of euxassay_012858. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012858_01 euxassay_012858_02 euxassay_012858_03 euxassay_012858_04
EMAGE:8929 EMAGE:8929 EMAGE:8929 EMAGE:8929 EMAGE:8929
euxassay_012858_05 euxassay_012858_06 euxassay_012858_07 euxassay_012858_08 euxassay_012858_09
EMAGE:8929 EMAGE:8929 EMAGE:8929 EMAGE:8929 EMAGE:8929
euxassay_012858_10 euxassay_012858_11 euxassay_012858_12 euxassay_012858_13 euxassay_012858_14
EMAGE:8929 EMAGE:8929 EMAGE:8929 EMAGE:8929 EMAGE:8929
euxassay_012858_15 euxassay_012858_16 euxassay_012858_17 euxassay_012858_18 euxassay_012858_19
EMAGE:8929 EMAGE:8929 EMAGE:8929 EMAGE:8929
euxassay_012858_20 euxassay_012858_21 euxassay_012858_22 euxassay_012858_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8929Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8929_wholemount_strong.wlz
8929_wholemount_moderate.wlz
8929_wholemount_weak.wlz
8929_wholemount_possible.wlz
8929_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8929_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 09 10 11 12
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 14 16 weak expression: see section 15
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12 13 14
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12 13 14
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 16 17
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 03 04 05 07 09 16 17
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 18 19 20 weak expression: see section 03 04 08 09
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 15 16 17 moderate expression: see section 13 14
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
renal cortex
weak weak
regionalweak expression: see section 05 06 07 08 15 16 17 18
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 03 04 05 19 20 21 22 weak expression: see section 06 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38514
Entity Detected:Hist1h1t, histone cluster 1, H1t ( MGI:1888530)
Sequence:sense strand is shown

>T38514
GTGAATAAAGGAGTCCTGGTGCAGACCAAGGGCACTGGCGCCTCAGGCTCCTTCAAGCTCAGTAAGAAGG
CGGCTTCTGGGAACGACAAGGGCAAGGGCAAGAAATCTGCTTCTGCCAAGGCTAAGAAGATGGGCTTGCC
CCGGGCCTCCAGATCTCCCAAGAGTAGCAAGACCAAGGCTGTCAAGAAGCCAAAGGCTACGCCCACAAAA
GCTTCTGGGAGCAGAAGGAAGACCAAAGGGGCCAAGGGCGTGCAGCAACGTAAAAGCCCCGCCAAAGCCA
GGGCAGCAAACCCCAATTCTGGGAAGGCAAAGATGGTCATGCAGAAGACCGATCTGAGGAAGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 150696. Forward Primer - name:150696_F_cDNA_Hist1h1t, sequence:GTGAATAAAGGAGTCCTGGTGC; Reverse Primer - name:150696_N_SP6_cDNA_Hist1h1t, sequence:GCCTTCCTCAGATCGGTCTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8928 same embryo
 EMAGE:8933 same embryo
 EMAGE:8931 same embryo
 EMAGE:8930 same embryo
 EMAGE:8932 same embryo
 EurExpress:euxassay_012858 same experiment
 MGI:4825377 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS