Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8933

Hist1h1b histone cluster 1, H1b ( MGI:1861461)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8933 EMAGE:8933 EMAGE:8933 EMAGE:8933 EMAGE:8933
"Pseudo-wholemount" of euxassay_012857. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012857_01 euxassay_012857_02 euxassay_012857_03 euxassay_012857_04
EMAGE:8933 EMAGE:8933 EMAGE:8933 EMAGE:8933 EMAGE:8933
euxassay_012857_05 euxassay_012857_06 euxassay_012857_07 euxassay_012857_08 euxassay_012857_09
EMAGE:8933 EMAGE:8933 EMAGE:8933 EMAGE:8933 EMAGE:8933
euxassay_012857_10 euxassay_012857_11 euxassay_012857_12 euxassay_012857_13 euxassay_012857_14
EMAGE:8933 EMAGE:8933 EMAGE:8933 EMAGE:8933 EMAGE:8933
euxassay_012857_15 euxassay_012857_16 euxassay_012857_17 euxassay_012857_18 euxassay_012857_19
EMAGE:8933 EMAGE:8933 EMAGE:8933 EMAGE:8933
euxassay_012857_20 euxassay_012857_21 euxassay_012857_22 euxassay_012857_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8933Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8933_wholemount_strong.wlz
8933_wholemount_moderate.wlz
8933_wholemount_weak.wlz
8933_wholemount_possible.wlz
8933_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8933_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 11 12 16 17
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 06 07 08 10 12 13 14 15
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 12 14 15 16 17 18 19 20
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 08 09 10 12 14 15 16 17 18 19 20
pons ventricular layer
weak weak
regionalweak expression: see section 06 08 09 10 13 14 15
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38513
Entity Detected:Hist1h1b, histone cluster 1, H1b ( MGI:1861461)
Sequence:sense strand is shown

>T38513
CACTAAGGCTGTTTCTGCCTCTAAGGAGCGCGGCGGCGTGTCCCTGCCTGCCCTTAAGAAGGCACTGGCT
GCTGGTGGCTACGATGTGGAGAAGAACAACAGCCGCATCAAGCTTGGGCTCAAGAGTCTGGTGAGCAAGG
GTACCCTGGTGCAGACCAAGGGCACCGGCGCCTCTGGTTCCTTCAAGCTTAACAAGAAGGCGGCTTCTGG
CGAGGCCAAGCCCAAGGCTAAGAAGACCGGGGCTGCCAAGGCCAAGAAGCCTGCAGGTGCTACCCCTAAA
AAGCCTAAGAAGACTGCGGGGGCAAAGAAGACCGTGAAGAAAACTCCAAAGAAAGCGAAGAAGCCTGCGG
CGGCTGGAGTGAAGAAAGTTGCCAAGAGTCCTAAGAAGGCCAAGGCTGCTGCCAAGCCTAAAAAAGCAGC
AAAGAGCCCGGCCAAGCCCAAGGCGGTGAAGTCTAAGGCATCCAAACCTAAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 150866. Forward Primer - name:150866_F_cDNA_Hist1h1b, sequence:CACTAAGGCTGTTTCTGCCTCT; Reverse Primer - name:150866_N_SP6_cDNA_Hist1h1b, sequence:CCTTAGGTTTGGATGCCTTAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8928 same embryo
 EMAGE:8929 same embryo
 EMAGE:8931 same embryo
 EMAGE:8930 same embryo
 EMAGE:8932 same embryo
 EurExpress:euxassay_012857 same experiment
 MGI:4825374 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS