Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10058

Tonsl tonsoku-like, DNA repair protein ( MGI:1919999)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10058 EMAGE:10058 EMAGE:10058 EMAGE:10058 EMAGE:10058
"Pseudo-wholemount" of euxassay_008190. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008190_01 euxassay_008190_02 euxassay_008190_03 euxassay_008190_04
EMAGE:10058 EMAGE:10058 EMAGE:10058 EMAGE:10058 EMAGE:10058
euxassay_008190_05 euxassay_008190_06 euxassay_008190_07 euxassay_008190_08 euxassay_008190_09
EMAGE:10058 EMAGE:10058 EMAGE:10058 EMAGE:10058 EMAGE:10058
euxassay_008190_10 euxassay_008190_11 euxassay_008190_12 euxassay_008190_13 euxassay_008190_14
EMAGE:10058 EMAGE:10058 EMAGE:10058 EMAGE:10058 EMAGE:10058
euxassay_008190_15 euxassay_008190_16 euxassay_008190_17 euxassay_008190_18 euxassay_008190_19
EMAGE:10058 EMAGE:10058 EMAGE:10058 EMAGE:10058 EMAGE:10058
euxassay_008190_20 euxassay_008190_21 euxassay_008190_22 euxassay_008190_23 euxassay_008190_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10058Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10058_wholemount_strong.wlz
10058_wholemount_moderate.wlz
10058_wholemount_weak.wlz
10058_wholemount_possible.wlz
10058_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10058_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 14 18 moderate expression: see section 15 16 17
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 18 19 20 weak expression: see section 21 22
thyroid gland
moderate moderate
regionalmoderate expression: see section 14 18 19 20
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 19 20 21 moderate expression: see section 02 03
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 14 15 16
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 24
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 18 19 20 21 22 23
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 10 11 12 13 14 18 19 20 21 22 23 24 weak expression: see section 06 07 08
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 23 24
naris
weak weak
regionalweak expression: see section 11 12 13 14 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 08 09 10 11 12 14 15 16 17
nasal cavity respiratory epithelium
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 11 14 15
vomeronasal organ
weak weak
regionalweak expression: see section 11 14
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16 17 weak expression: see section 13
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 19 20
liver lobe
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 01 02 03 04 05
renal cortex
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T406
Entity Detected:Tonsl, tonsoku-like, DNA repair protein ( MGI:1919999)
Sequence:sense strand is shown

>T406
TCCTGAGCCACCAGGCTGCCCTGGGCGGTGCCTTCCAAGATGCTGTGCACCTGAAAACCTTGTCCTTATC
GTACAATCTGCTCGGCGCTCCTGCCCTGGCGAGGGTGCTGCAGACCTTACCCGCCTGTACCCTCAAACGT
CTGGACCTAAGCTCTGTGGCAGCCAGCAAGAGCAACTCGGGTATCATAGAGCCTGTTATCAAATACTTGA
CCAAGGAAGGCTGTGCTCTGGCCCACCTAACCCTGTCCGCAAACTGCCTGGGTGACAAGGCCGTGAGAGA
ACTGAGCAGATGTCTCCCTTGCTGCCCCTCACTCACCTCTCTGGACCTGTCTGCCAACCCCGAGGTCAGC
TGTGCCAGTCTAGAGGAGCTCTTGTCTGCCCTCCAAGAGCGGTCCCAAGGCCTCAGCTTCCTTGGCCTAT
CAGGCTGCTCTATTCAGGGGCCGCTGAACTCTGACCTCTGGGACAAGATCTTCGTGCAGTT
Notes:The probe template was PCR amplified from IMAGE:3157197 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3157197 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10056 same embryo
 EMAGE:10057 same embryo
 EMAGE:10055 same embryo
 EurExpress:euxassay_008190 same experiment
 MGI:4826694 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS