Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10100

Spire2 spire homolog 2 (Drosophila) ( MGI:2446256)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10100 EMAGE:10100 EMAGE:10100 EMAGE:10100 EMAGE:10100
"Pseudo-wholemount" of euxassay_000098. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000098_01 euxassay_000098_02 euxassay_000098_03 euxassay_000098_04
EMAGE:10100 EMAGE:10100 EMAGE:10100 EMAGE:10100 EMAGE:10100
euxassay_000098_05 euxassay_000098_06 euxassay_000098_07 euxassay_000098_08 euxassay_000098_09
EMAGE:10100 EMAGE:10100 EMAGE:10100 EMAGE:10100 EMAGE:10100
euxassay_000098_10 euxassay_000098_11 euxassay_000098_12 euxassay_000098_13 euxassay_000098_14
EMAGE:10100 EMAGE:10100 EMAGE:10100 EMAGE:10100 EMAGE:10100
euxassay_000098_15 euxassay_000098_16 euxassay_000098_17 euxassay_000098_18 euxassay_000098_19
EMAGE:10100 EMAGE:10100 EMAGE:10100 EMAGE:10100
euxassay_000098_20 euxassay_000098_21 euxassay_000098_22 euxassay_000098_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10100Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10100_wholemount_strong.wlz
10100_wholemount_moderate.wlz
10100_wholemount_weak.wlz
10100_wholemount_possible.wlz
10100_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10100_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 21
forelimb
weak weak
single cellweak expression: see section 01
hindlimb
weak weak
single cellweak expression: see section 07
leg
moderate moderate
single cellmoderate expression: see section 08 weak expression: see section 07
hip
moderate moderate
regionalmoderate expression: see section 08
oral region gland
moderate moderate
homogeneousmoderate expression: see section 16
submandibular gland primordium
moderate moderate
homogeneousmoderate expression: see section 16 weak expression: see section 17
pituitary gland
strong strong
single cellstrong expression: see section 11 moderate expression: see section 12
facial vii ganglion
strong strong
spottedstrong expression: see section 07 moderate expression: see section 14
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 06 18 weak expression: see section 15 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 07 08 17 20 21 moderate expression: see section 05 06 16 18 weak expression: see section 02 03 19
vagus x ganglion
strong strong
regionalstrong expression: see section 07 moderate expression: see section 05 06 weak expression: see section 15
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 06
spinal cord floor plate
weak weak
gradedweak expression: see section 13
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 07 08 moderate expression: see section 14 15 17 18 20 weak expression: see section 11 19
heart ventricle
strong strong
single cellstrong expression: see section 07 10 moderate expression: see section 12 14 weak expression: see section 09 15
interventricular groove
moderate moderate
single cellmoderate expression: see section 12
heart left ventricle
strong strong
single cellstrong expression: see section 11
left ventricle endocardial lining
strong strong
single cellstrong expression: see section 07 08 10
heart right ventricle
strong strong
single cellstrong expression: see section 11
stomach fundus
moderate moderate
single cellexpression in the associated mesenchyme.
mandible
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 15
meckel's cartilage
weak weak
regionalweak expression: see section 11
lower jaw mesenchyme
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 11 15
urinary system
strong strong
regionalstrong expression: see section 15
not examined not examined
othernot examined expression: see section 15
urethra of male
moderate moderate
homogeneousmoderate expression: see section 15 16
urethral fold of male
moderate moderate
homogeneousmoderate expression: see section 16
lung
strong strong
spottedstrong expression: see section 07 08 moderate expression: see section 05 06 15 16 weak expression: see section 17 18 19
frontal bone primordium
weak weak
regionalweak expression: see section 02
facial bone primordium
weak weak
regionalweak expression: see section 02
pectoral girdle and thoracic body wall skeleton
moderate moderate
single cellmoderate expression: see section 03 04 05 weak expression: see section 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1535
Entity Detected:Spire2, spire homolog 2 (Drosophila) ( MGI:2446256)
Sequence:sense strand is shown

>T1535
TTTTTTTTTTTTTTATAAATATAGGCCATATATATATTATAAATGTATCTATATATGTATATATGTACAT
GCGCAAGGGTGGGGGGGCTGATGGCAGCTGTGTTCCAGGATGGGGTGTGGGGAGGCCATCACAACAGTCA
TTGGAAGTTGAGAGTCCTGGTGTTGGGGATATAGAGGGACTGGGTCTGACGGCTTCGTCGTGGAGTGGCA
TTGAGGACATCCACGCTCTTGCGGCTGGAGCACACGACATCAGCCACAAAGCTGGTGCAGTCACTGCAGA
CATCCTTTAGCGGACGCGTGG
Notes:The probe template was PCR amplified from IMAGE:821884 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:821884 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10099 same embryo
 EMAGE:10102 same embryo
 EMAGE:10103 same embryo
 EMAGE:10101 same embryo
 EurExpress:euxassay_000098 same experiment
 MGI:4828415 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS