Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10131

Zdhhc2 zinc finger, DHHC domain containing 2 ( MGI:1923452)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10131 EMAGE:10131 EMAGE:10131 EMAGE:10131 EMAGE:10131
"Pseudo-wholemount" of euxassay_000126. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000126_01 euxassay_000126_02 euxassay_000126_03 euxassay_000126_04
EMAGE:10131 EMAGE:10131 EMAGE:10131 EMAGE:10131 EMAGE:10131
euxassay_000126_05 euxassay_000126_06 euxassay_000126_07 euxassay_000126_08 euxassay_000126_09
EMAGE:10131 EMAGE:10131 EMAGE:10131 EMAGE:10131 EMAGE:10131
euxassay_000126_10 euxassay_000126_11 euxassay_000126_12 euxassay_000126_13 euxassay_000126_14
EMAGE:10131 EMAGE:10131 EMAGE:10131 EMAGE:10131 EMAGE:10131
euxassay_000126_15 euxassay_000126_16 euxassay_000126_17 euxassay_000126_18 euxassay_000126_19
EMAGE:10131 EMAGE:10131 EMAGE:10131 EMAGE:10131
euxassay_000126_20 euxassay_000126_21 euxassay_000126_22 euxassay_000126_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10131Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10131_wholemount_strong.wlz
10131_wholemount_moderate.wlz
10131_wholemount_weak.wlz
10131_wholemount_possible.wlz
10131_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10131_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
regionalmoderate expression: see section 10
diencephalon gland
weak weak
regionalweak expression: see section 14
hypothalamus
strong strong
regionalstrong expression: see section 11 12 13 14 15 moderate expression: see section 10 weak expression: see section 09
diencephalon lamina terminalis
strong strong
regionalstrong expression: see section 12 14 moderate expression: see section 10 11
thalamus
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 15 16 17
corpus striatum
strong strong
regionalstrong expression: see section 02 03 04 05 07 19 20 22 23 moderate expression: see section 06 08 14 15 18 21
telencephalon mantle layer
strong strong
homogeneousstrong expression: see section 11
olfactory lobe
strong strong
regionalstrong expression: see section 14 moderate expression: see section 13
olfactory cortex
strong strong
regionalstrong expression: see section 14 moderate expression: see section 12 13 15
medulla oblongata basal plate
strong strong
regionalstrong expression: see section 14 moderate expression: see section 11 12 15 16
metencephalon basal plate
strong strong
regionalstrong expression: see section 11 14 moderate expression: see section 12 15 16
tegmentum
strong strong
regionalstrong expression: see section 11 12
cranial ganglion
strong strong
homogeneousstrong expression: see section 08 09
facial vii ganglion
strong strong
homogeneousstrong expression: see section 04 06 07 08 09 17
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 04 06 07 08 09 16 17
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 16 17 18 19 20 21 22 weak expression: see section 15
vagus x ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 16 17 18 moderate expression: see section 03 10 15
inferior vagus x ganglion
moderate moderate
regionalmoderate expression: see section 15
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 16 17 18 21 22 moderate expression: see section 03
cranial nerve
strong strong
spottedstrong expression: see section 07
abducent vi nerve
strong strong
regionalstrong expression: see section 16 17 18
accessory xi nerve
strong strong
homogeneousstrong expression: see section 08 15
facial vii nerve
strong strong
regionalstrong expression: see section 08 18 moderate expression: see section 10
glossopharyngeal ix nerve
strong strong
regionalstrong expression: see section 08 15 moderate expression: see section 13
hypoglossal xii nerve
strong strong
homogeneousstrong expression: see section 08 13
oculomotor iii nerve
strong strong
regionalstrong expression: see section 08 16 17
olfactory i nerve
strong strong
regionalstrong expression: see section 08 13 14 15 16 moderate expression: see section 10
optic ii nerve
strong strong
homogeneousstrong expression: see section 08 09 17
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 09 18 19 moderate expression: see section 10
trigeminal v nerve mandibular division
strong strong
homogeneousstrong expression: see section 05 07 16 19 20
trigeminal v nerve maxillary division
strong strong
homogeneousstrong expression: see section 07 08 09 16 18 19
trigeminal v nerve ophthalmic division
strong strong
homogeneousstrong expression: see section 07 08 09 19
trochlear iv nerve
strong strong
homogeneousstrong expression: see section 08 09
vestibulocochlear viii nerve
strong strong
homogeneousstrong expression: see section 09 15 16 19 21 22
spinal cord
strong strong
regionalstrong expression: see section 14
spinal cord lateral wall
strong strong
regionalstrong expression: see section 13
spinal cord mantle layer
strong strong
regionalstrong expression: see section 13
spinal cord sulcus limitans
strong strong
regionalstrong expression: see section 12 13
autonomic nervous system
strong strong
homogeneousstrong expression: see section 08
autonomic nerve plexus
strong strong
regionalstrong expression: see section 08 09 10 moderate expression: see section 07 12 18 19 21 23
parasympathetic nervous system
strong strong
regionalstrong expression: see section 08 10 moderate expression: see section 07 09 17 18 19 21
sympathetic nervous system
strong strong
regionalstrong expression: see section 08 10 moderate expression: see section 07 09 17 18 19 21
cervico-thoracic ganglion
moderate moderate
spottedmoderate expression: see section 23
thoracic ganglion
moderate moderate
spottedmoderate expression: see section 23
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 09 10 11 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1595
Entity Detected:Zdhhc2, zinc finger, DHHC domain containing 2 ( MGI:1923452)
Sequence:sense strand is shown

>T1595
GCAGCTATGTTTTCTGTCAGCTTGTCCTCTCTGTTTGGTTATCATTGCTGGCTAGTCAGCAAAAATAAAT
CTACTTTAGAGGCATTCAGAAATCCAGTATTTAGACACGGAACAGATAAGAACGGATTCAGCTTGGGTTT
CAGTAAAAACATGAGACAAGTGTTTGGTGATGAGAAGAAATACTGGCTGTTACCAGTATTTTCAAGTCAA
GGTGATGGCTGTTCCTTTCCAACTTGCCTTGTTAACCAGGATCCTGAACAACCTTCTACTCCTGCGGGAC
TAAATTCAACAGTGAAAAATCCTGAAAACCACCAGTTTCCTGCAAAGCCTCTGAGAGAGTCCCAGAGCCA
CCTCCTTAAGGATTCTCAGACCTGGACAGAGAGCATCGCAAACGCTGGGAAGGGCAAAGCCGGTATGAGC
AACCCTGCATTAACTATGGAGAACGAGACTTAGTTCTACAATCAAAATAAAACCACTCTTGT
Notes:The probe template was PCR amplified from IMAGE:990251 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:990251 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10130 same embryo
 EMAGE:10134 same embryo
 EMAGE:10132 same embryo
 EMAGE:10133 same embryo
 EurExpress:euxassay_000126 same experiment
 MGI:4829281 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS