Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10374

H28 histocompatibility 28 ( MGI:95975)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10374 EMAGE:10374 EMAGE:10374 EMAGE:10374 EMAGE:10374
"Pseudo-wholemount" of euxassay_000516. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000516_01 euxassay_000516_02 euxassay_000516_03 euxassay_000516_04
EMAGE:10374 EMAGE:10374 EMAGE:10374 EMAGE:10374 EMAGE:10374
euxassay_000516_05 euxassay_000516_06 euxassay_000516_07 euxassay_000516_08 euxassay_000516_09
EMAGE:10374 EMAGE:10374 EMAGE:10374 EMAGE:10374 EMAGE:10374
euxassay_000516_10 euxassay_000516_11 euxassay_000516_12 euxassay_000516_13 euxassay_000516_14
EMAGE:10374 EMAGE:10374 EMAGE:10374 EMAGE:10374 EMAGE:10374
euxassay_000516_15 euxassay_000516_16 euxassay_000516_17 euxassay_000516_18 euxassay_000516_19
EMAGE:10374 EMAGE:10374 EMAGE:10374
euxassay_000516_20 euxassay_000516_21 euxassay_000516_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10374Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10374_wholemount_strong.wlz
10374_wholemount_moderate.wlz
10374_wholemount_weak.wlz
10374_wholemount_possible.wlz
10374_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10374_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
moderate moderate
regionalmoderate expression: see section 06 14
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 05 15
hypothalamus mantle layer
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 weak expression: see section 07 08 09 10
diencephalon lateral wall mantle layer
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 weak expression: see section 05 06 07 08 09 10
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 11 12 13 14 15 16 17 18
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 07 08 09 11 12 13
medulla oblongata
weak weak
homogeneousweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
metencephalon
moderate moderate
homogeneousmoderate expression: see section 02 03 04 weak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain
weak weak
homogeneousweak expression: see section 04 05 06 07 08 09 11 12 13 14 15 16 17
facial vii ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 17 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 16 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 15 16 17 18 19
vagus x ganglion
strong strong
regionalstrong expression: see section 07 15
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 15 16 17
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 09 14
cervical ganglion
strong strong
regionalstrong expression: see section 08 15
thoracic ganglion
strong strong
regionalstrong expression: see section 10 11 12 13 14
not examined not examined
regionalnot examined expression: see section 19 20 21 22
retina
moderate moderate
regionalmoderate expression: see section 19 20 21 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 11 12 weak expression: see section 05 06 07 13 14 15
urethra of male
strong strong
regionalstrong expression: see section 11 15
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 13 15 16 weak expression: see section 14
tail dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3870
Entity Detected:H28, histocompatibility 28 ( MGI:95975)
Sequence:sense strand is shown

>T3870
GCTTTAGAAAGGAGCCAGGTTACCAGTATCCTCGAGAGGCAAGTCCTCTAAGGCATCATCCGCAGCCCTC
AACATCTGCCTGAGAGCAGCAAAGACCAGAATATCCTTCATAGGCTCCAACCTTCGCTCTGAAGCATAAT
TGCTGACCATCAAGATATTGGCTATAGGAATATTTAGCCATTTTTGGACATTCTGAACCTGGCTTAGAGA
AGTCACAGTTTCTGTCATGTTTGCAAAACTGTCATCAAGAACTTCATCATACTCCTCCACATTTGTAAGC
AAGGCTACATATCCTATACCACAGTCTACTACATCTTTGCGAATTTTTTTCAGCTTTGCCACCATTTTAT
CAGATAGTGTATTAACAGAGTTGATGTCTAGGACAAAAGCCACGCAGTGAATCCTGTCCTTCAGGGGCGG
AGAGGCGGCGTGAGGGGAGTGCTTCGGCTTCATCGGCTCACAGGGTTGAACTGATACCTGTCTGGTACAC
AGCCTTGTAAGATATGAGGAATGTCATCTATGCACAG
Notes:The probe template was PCR amplified from IMAGE:3215259 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3215259 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10376 same embryo
 EMAGE:10375 same embryo
 EMAGE:10378 same embryo
 EMAGE:10373 same embryo
 EMAGE:10377 same embryo
 EurExpress:euxassay_000516 same experiment
 MGI:4825300 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS