Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10421

Snap91 synaptosomal-associated protein 91 ( MGI:109132)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10421 EMAGE:10421 EMAGE:10421 EMAGE:10421 EMAGE:10421
"Pseudo-wholemount" of euxassay_000563. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000563_01 euxassay_000563_02 euxassay_000563_03 euxassay_000563_04
EMAGE:10421 EMAGE:10421 EMAGE:10421 EMAGE:10421 EMAGE:10421
euxassay_000563_05 euxassay_000563_06 euxassay_000563_07 euxassay_000563_08 euxassay_000563_09
EMAGE:10421 EMAGE:10421 EMAGE:10421 EMAGE:10421 EMAGE:10421
euxassay_000563_10 euxassay_000563_11 euxassay_000563_12 euxassay_000563_13 euxassay_000563_14
EMAGE:10421 EMAGE:10421 EMAGE:10421 EMAGE:10421 EMAGE:10421
euxassay_000563_15 euxassay_000563_16 euxassay_000563_17 euxassay_000563_18 euxassay_000563_19
EMAGE:10421 EMAGE:10421 EMAGE:10421 EMAGE:10421 EMAGE:10421
euxassay_000563_20 euxassay_000563_21 euxassay_000563_22 euxassay_000563_23 euxassay_000563_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10421Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10421_wholemount_strong.wlz
10421_wholemount_moderate.wlz
10421_wholemount_weak.wlz
10421_wholemount_possible.wlz
10421_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10421_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
limb
moderate moderate
regionalmoderate expression: see section 01
hindlimb
moderate moderate
regionalmoderate expression: see section 22 23 24
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 16 17 18 19 20 21 22
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 11 12 15 16 17 19 20 21 22 23 24
foregut-midgut junction
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 14 15
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 11 13 14 15 16 17 18
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20 21 22 23
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 07 08 09 10 12 13 14 15 16
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 03 04
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 19 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 08 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 17 18 19
spinal cord mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 10 11 16 17
cervical ganglion
strong strong
regionalstrong expression: see section 09 17
thoracic ganglion
strong strong
regionalstrong expression: see section 11 12 13 14 15
not examined not examined
regionalnot examined expression: see section 01 21 22 23 24
neural retina
strong strong
regionalstrong expression: see section 01 21 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 13 weak expression: see section 06 07 14 15 16
heart
moderate moderate
regionalmoderate expression: see section 08
heart atrium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 weak expression: see section 19 20
heart ventricle
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06
hindgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10
midgut
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12
kidney calyx
moderate moderate
regionalmoderate expression: see section 16 17 18 19 20
urethra of male
moderate moderate
regionalmoderate expression: see section 10 13 14
tail dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 12 15 16 17 18 19
extraembryonic component
moderate moderate
regionalmoderate expression: see section 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3767
Entity Detected:Snap91, synaptosomal-associated protein 91 ( MGI:109132)
Sequence:sense strand is shown

>T3767
TGGCCTCGAGGCCAGAATTCGGACGAGGGCCAACTGGCAACCGAAAGTCACTCCAGCCACATGGTCAGCG
GGTGTTCCCCCGCAAGGCACTGTTCCACCAACCAGCTCAGTCCCTCCGGGTGCCGGGGCCCCGTCCGTTG
GGCAACCTGGAGCAGGATTTGGAATGCCTCCTTCAGGGACAGGCATGACCATGATGTCTCAGCAGCCAGT
CATGTTTGCACAGCCCATGATGAGGCCACCCTTTGGAGCTGCAGCTGTGCCCGGCACACAGCTTTCTCCA
AGCCCTACACCTGCCACTCAGAGTCCCAAGAAACCTCCAGCCAAGGACCCGTTAGCGGATCTTAACATCA
AGGATTTCTTGTAAACAATTTAAGCTGCAATTTTTGTGACTGAATAGGAAAAAACTAACCTGAGTTTGGA
AACTTCAGATAAGATTGATGCTCAGTTTCAAAGTGAGCCACCAGTACCAAACCCAGTGCTGACGCGTAAC
TTCCTCTCCCAAGCACACAGCCCAGCTGTGGCAGTGAACATTAGGAATGTGTACTCTTTAG
Notes:The probe template was PCR amplified from IMAGE:387263 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:387263 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10426 same embryo
 EMAGE:10423 same embryo
 EMAGE:10422 same embryo
 EMAGE:10425 same embryo
 EMAGE:10424 same embryo
 EurExpress:euxassay_000563 same experiment
 MGI:4828344 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS