Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11019

Hmga1 high mobility group AT-hook 1 ( MGI:96160)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11019 EMAGE:11019 EMAGE:11019 EMAGE:11019 EMAGE:11019
"Pseudo-wholemount" of euxassay_003457. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003457_01 euxassay_003457_02 euxassay_003457_03 euxassay_003457_04
EMAGE:11019 EMAGE:11019 EMAGE:11019 EMAGE:11019 EMAGE:11019
euxassay_003457_05 euxassay_003457_06 euxassay_003457_07 euxassay_003457_08 euxassay_003457_09
EMAGE:11019 EMAGE:11019 EMAGE:11019 EMAGE:11019 EMAGE:11019
euxassay_003457_10 euxassay_003457_11 euxassay_003457_12 euxassay_003457_13 euxassay_003457_14
EMAGE:11019 EMAGE:11019 EMAGE:11019 EMAGE:11019 EMAGE:11019
euxassay_003457_15 euxassay_003457_16 euxassay_003457_17 euxassay_003457_18 euxassay_003457_19
EMAGE:11019 EMAGE:11019 EMAGE:11019 EMAGE:11019 EMAGE:11019
euxassay_003457_20 euxassay_003457_21 euxassay_003457_22 euxassay_003457_23 euxassay_003457_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11019Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11019_wholemount_strong.wlz
11019_wholemount_moderate.wlz
11019_wholemount_weak.wlz
11019_wholemount_possible.wlz
11019_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11019_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
head mesenchyme
weak weak
regionalweak expression: see section 01 02 03 04 05 06 22 23 24
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
spleen primordium
moderate moderate
regionalmoderate expression: see section 05 23 24
thymus primordium
strong strong
homogeneousstrong expression: see section 12 13 14 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 09 10 16 17 18 19 20
pancreas
strong strong
regionalstrong expression: see section 10 11 12 13 17 moderate expression: see section 18 19 20
thyroid gland
strong strong
regionalstrong expression: see section 10 11 12 15 16
pituitary gland
moderate moderate
regionalmoderate expression: see section 12 13 14 weak expression: see section 11 15
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 09 19 21 24 moderate expression: see section 03 04 22 23
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 10
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 08 09 10 11 18 19 20 weak expression: see section 05 06 07 12 15 16 17 21 22
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 16 17 18 19 20 21
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 weak expression: see section 16
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 23 24
neural retina
strong strong
homogeneousstrong expression: see section 01 02 moderate expression: see section 03 22 23 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 10 11 12 14 15 16 17 18 19 moderate expression: see section 09
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 11 12 13 15 16
esophagus
moderate moderate
regionalmoderate expression: see section 12 13 14
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11
hindgut
strong strong
regionalstrong expression: see section 15 16 17 18
rectum
weak weak
regionalweak expression: see section 15 16
midgut
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 12 15 16 17
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
moderate moderate
regionalmoderate expression: see section 14 15 16
renal cortex
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 18 19 20 21 weak expression: see section 22
maturing glomerular tuft
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 18 19 20 21 weak expression: see section 22
testis
strong strong
regionalstrong expression: see section 06 07 08 09 moderate expression: see section 21 22 23 24
urethra of male
moderate moderate
regionalmoderate expression: see section 15 16
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 12 13 14
left lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11
right lung
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20 21 22 23 24
trachea
moderate moderate
regionalmoderate expression: see section 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6251
Entity Detected:Hmga1, high mobility group AT-hook 1 ( MGI:96160)
Sequence:sense strand is shown

>T6251
CCGAGTCGGGGCTATTTCTGGTGTTGGCGCGGCTCCAAGAAGGCACTCACTGTGTGCTGCCCCACACATA
GAGAAGGAGAATGAGCGAGTCGGGCTCAAAGTCCAGCCAGCCCCTGGCCTCCAAACAGGAAAAGGATGGG
ACTGAGAAGCGAGGCCGGGGCAGGCCACGCAAGCAGCCTCCGAAAGAGCCCAGTGAAGTGCCAACTCCGA
AGAGACCTCGGGGCCGACCAAAGGGAAGCAAGAATAAGGGCGCCGCCAAGACCCGGAAAGTCACCACAGC
TCCAGGGAGGAAACCAAGGGGCAGACCCAAGAAACTGGAGAAGGAGGAAGAGGAGGGCATCTCCCAGGAG
TCCTCTGAGGAGGAGCAGTGATCACCACTCGCAGTGCCGCCTGCTCCATAGCCACTGAGGAGCAGCTGTC
CCCTGGGACTGGAAGCCCTGCTCCCAGGCCCCTCCCCGCCCCCACTGCACACTACCGCACCAGGCACCAG
CTGCAGGCTCTGCTCCGCAGCACCCAAGGGAGCAGGATTCGGCTCAGTCCCTGTGCCCTCCTCCCGAACA
CACCTGCCCCATCCTGACAAGGCTAACTTCCCATTTAGCCGCAGCCCGGCCTGCTGCGCACCTCCCTCAG
AGCCGTGGCTCTCTGGGCGCTTTGTTTTGCGGGTCCCTTCTGCCCTGCTGTTCCTGGCTTCCCCGTAGAG
GGTCCTGGGAGCATTCCCTGGCCTTAAGGGGCCCCGGCCCCATCTCACTCTGACAAGGCCCAGTGGCTGA
CCTAGCAGCAGCAGTGTGGTCAGGGCAGGGGATGCTTAGATCCCAGCATGTCCCCACCAAAGTATCACCG
GGTGGGTTTCTCAGCCCCTCCTGCCCCACCCTACAGAGATCATGCACTGGGTTGGCTGAGCCCCTTGACA
ACAGGAAGTAGGATGATGTTGGCTCCACCCACTTTAATGTTCTCACCTGAGACTAGACAGATGGGGTTAC
CGCCCATCTCCAGAGTAAGGGCCTGTTCTCGCCTCCACCAAAGGCAAACGGGCACCAACACGCCTCCCCC
AGTCCACTCTAGGCTGTTCCTTCCTCCCGCAGGGCACTAAGGAGCTAGCCTTGCCGCCCCCTCCTTTTCG
CTCCTCCCTGCCCCCCATGGTTCTGGTTCCATCTTCTCCTCTGTTCACAAACTACCTCTGGACGGTTGTG
TTGTTTTTTTTTTGTTCCATGTTCATTCTTAGATACCCACTATTGCTGCTGCTACCAGCGTCAGATGTTC
ATCCTCCTGAATTTGCCTGTATTCTCTCCCCCACACAATACACTCGAGGGGAAGGGGGGCTGGGGCGCAG
CAGACTGGTTACCTACCCCACACTAAGGAAGATGGGGCCCCACCCCGTGGATGCTGCAGCAGAGTGAGGA
TGGGGGCCCACTTTGATGGGAAAAGGGTGTAGGGCCACCTCCCCTTGTTCTGTGGGGGAGGGGTGGCCAG
TATTTGTCCCAGCCTGGGGCTTCCTCCCTGGTTTCTTATTTGCAGTTACTTGAATAAAAAACAAATAGCC
AAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3500572 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3500572 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11020 same assay
 EMAGE:11023 same embryo
 EMAGE:11022 same embryo
 EMAGE:11021 same embryo
 EurExpress:euxassay_003457 same experiment
 MGI:4825389 same experiment
 MGI:4825388 same experiment
 EMAGE:11018 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS