Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11923

Krt18 keratin 18 ( MGI:96692)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11923 EMAGE:11923 EMAGE:11923 EMAGE:11923 EMAGE:11923
"Pseudo-wholemount" of euxassay_011031. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011031_01 euxassay_011031_02 euxassay_011031_03 euxassay_011031_04
EMAGE:11923 EMAGE:11923 EMAGE:11923 EMAGE:11923 EMAGE:11923
euxassay_011031_05 euxassay_011031_06 euxassay_011031_07 euxassay_011031_08 euxassay_011031_09
EMAGE:11923 EMAGE:11923 EMAGE:11923 EMAGE:11923 EMAGE:11923
euxassay_011031_10 euxassay_011031_11 euxassay_011031_12 euxassay_011031_13 euxassay_011031_14
EMAGE:11923 EMAGE:11923 EMAGE:11923 EMAGE:11923 EMAGE:11923
euxassay_011031_15 euxassay_011031_16 euxassay_011031_17 euxassay_011031_18 euxassay_011031_19
EMAGE:11923 EMAGE:11923 EMAGE:11923 EMAGE:11923
euxassay_011031_20 euxassay_011031_21 euxassay_011031_22 euxassay_011031_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11923Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11923_wholemount_strong.wlz
11923_wholemount_moderate.wlz
11923_wholemount_weak.wlz
11923_wholemount_possible.wlz
11923_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11923_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
homogeneousstrong expression: see section 10 11 12 13 14 15
sublingual gland primordium
strong strong
regionalstrong expression: see section 10 11 17
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19 20 21
pancreas
strong strong
regionalstrong expression: see section 08 09 10 11 14 15 moderate expression: see section 16 17 18
thyroid gland
moderate moderate
regionalmoderate expression: see section 10 11 12 15 weak expression: see section 16
pituitary gland
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 11 12 13
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
saccule
moderate moderate
regionalmoderate expression: see section 01 03 04 07 18 19 20 21
cochlea
moderate moderate
regionalmoderate expression: see section 01 02 04 05 06 07 08 09 17 18 19 20 21 22 weak expression: see section 16
lateral semicircular canal
moderate moderate
regionalmoderate expression: see section 01 05 06 07 18
posterior semicircular canal
moderate moderate
regionalmoderate expression: see section 03 04 19 20
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 16 17 18 19
cornea epithelium
strong strong
regionalstrong expression: see section 05 23 moderate expression: see section 02 03 04
optic stalk
moderate moderate
regionalmoderate expression: see section 01
naris
strong strong
regionalstrong expression: see section 14 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20 21 moderate expression: see section 09
esophagus
moderate moderate
regionalmoderate expression: see section 11 12 13
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10
hindgut
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 15
rectum
strong strong
regionalstrong expression: see section 13 14
midgut
strong strong
regionalstrong expression: see section 06 07 13 14 moderate expression: see section 08 09 10 11 12 15 16 17 18 19 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 17 18 weak expression: see section 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 19 20
oral epithelium
moderate moderate
regionalmoderate expression: see section 06 07 09 10 11 12 13 14 15 16 17 18 weak expression: see section 19 20 21
palatal shelf epithelium
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 17 18 weak expression: see section 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 20
urinary system
strong strong
spottedstrong expression: see section 03 04 05 06 20 21 22
bladder
strong strong
regionalExpression in the fundus region.
kidney calyx
strong strong
regionalstrong expression: see section 06 07 09 10 16 17 18 19 20
kidney pelvis
strong strong
regionalstrong expression: see section 08 09 17 18
male reproductive system
strong strong
regionalstrong expression: see section 13 14
urethra of male
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 15
larynx
moderate moderate
regionalmoderate expression: see section 11 12 13 14
lung
strong strong
regionalstrong expression: see section 02 03 05 06 09 13 14 15 17 18 19 20 21 22 23 moderate expression: see section 04 07 08 10 11 12 16
trachea
moderate moderate
regionalmoderate expression: see section 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36568
Entity Detected:Krt18, keratin 18 ( MGI:96692)
Sequence:sense strand is shown

>T36568
AGAGCCTGGAAACTGAGAACAGGAGACTGGAGAGCAAAATCCGGGAACATCTGGAGAAGAAGGGGCCCCA
GGGCGTCAGAGACTGGGGCCACTACTTCAAGATCATCGAAGACCTGAGGGCTCAGATCCTTGCGAATTCT
GTGGACAATGCCCGCATCGTCTTGCAGATCGACAATGCCCGCCTTGCCGCCGATGACTTTAGAGTCAAGT
ATGAGACAGAACTAGCCATGCGCCAGTCTGTGGAGAGCGACATCCATGGACTCCGCAAGGTGGTAGATGA
CACCAACATCACAAGGCTGCAGCTGGAGACAGAAATCGAGGCACTCAAGGAAGAACTTCTGTTCATGAAG
AAGAATCATGAAGAGGAAGTCCAAGGTCTGGAAGCCCAGATTGCCAGCTCTGGATTGACTGTGGAAGTGG
ATGCCCCCAAATCTCAGGACCTCAGCAAGATCATGGCGGACATCCGCGCCCAGTATGAAGCGCTGGCTCA
GAAGAACCGCGAGGAACTGGACAAGTACTGGTCTCAGCAGATTGAGGAGAGTACCACAGTTGTCACCACC
AAGTCTGCCGAAATCAGGGACGCTGAGACCACACTCACGGAGCTGAGACGCACCCTCCAGACCTTGGAGA
TTGACTTGGACTCCATGAAAAACCAGAACATCAACTTGGAGAACAGCCTCGGGGATGTGGAGGCCCGATA
CAAGGCACAGATGGAGCAGCTCAATGGGGTCCTTCTGCATCTGGAGTCAGAGCTGGCACAAAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90156. Forward Primer - name:090156_F_cDNA_Krt1-18, sequence:AGAGCCTGGAAACTGAGAACAG; Reverse Primer - name:090156_N_SP6_cDNA_Krt1-18, sequence:GTTTGTGCCAGCTCTGACTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11925 same embryo
 EMAGE:11928 same embryo
 EMAGE:11927 same embryo
 EMAGE:11924 same embryo
 EMAGE:11926 same embryo
 EurExpress:euxassay_011031 same experiment
 MGI:4825830 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS