Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12072

Ism1 isthmin 1 homolog (zebrafish) ( MGI:2442963)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12072 EMAGE:12072 EMAGE:12072 EMAGE:12072 EMAGE:12072
"Pseudo-wholemount" of euxassay_009556. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009556_01 euxassay_009556_02 euxassay_009556_03 euxassay_009556_04
EMAGE:12072 EMAGE:12072 EMAGE:12072 EMAGE:12072 EMAGE:12072
euxassay_009556_05 euxassay_009556_06 euxassay_009556_07 euxassay_009556_08 euxassay_009556_09
EMAGE:12072 EMAGE:12072 EMAGE:12072 EMAGE:12072 EMAGE:12072
euxassay_009556_10 euxassay_009556_11 euxassay_009556_12 euxassay_009556_13 euxassay_009556_14
EMAGE:12072 EMAGE:12072 EMAGE:12072 EMAGE:12072 EMAGE:12072
euxassay_009556_15 euxassay_009556_16 euxassay_009556_17 euxassay_009556_18 euxassay_009556_19
EMAGE:12072 EMAGE:12072 EMAGE:12072 EMAGE:12072 EMAGE:12072
euxassay_009556_20 euxassay_009556_21 euxassay_009556_22 euxassay_009556_23 euxassay_009556_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12072Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12072_wholemount_strong.wlz
12072_wholemount_moderate.wlz
12072_wholemount_weak.wlz
12072_wholemount_possible.wlz
12072_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12072_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
radius
weak weak
regionalweak expression: see section 01
humerus
weak weak
regionalweak expression: see section 05 06 07
forelimb digit 2 phalanx
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07
forelimb digit 3 phalanx
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07
forelimb digit 4 phalanx
weak weak
regionalweak expression: see section 07
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 05 23 weak expression: see section 04 24
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 05 22 23 weak expression: see section 04 24
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 05 22 23 weak expression: see section 04
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 05 06 22 23
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 06 22 23
femur
weak weak
regionalweak expression: see section 03
adrenal cortex
weak weak
regionalweak expression: see section 11 12 13 21 22 23
esophagus
weak weak
regionalweak expression: see section 15
mandible
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 17 18 19 20 21
maxilla
weak weak
regionalweak expression: see section 09 10 11 12 13 14 17 18 19 20 21
metanephros
weak weak
regionalweak expression: see section 10 11 12 13 14 20 21 22 23
left lung
moderate moderate
regionalmoderate expression: see section 05 06 07 09 10 11 13 14 weak expression: see section 08 12
right lung
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19 21 22 23 weak expression: see section 20 24
trachea
weak weak
regionalweak expression: see section 15 16
axial skeleton
weak weak
regionalweak expression: see section 21 22
sternum
weak weak
regionalweak expression: see section 03 14 15 16
axial skeleton tail region
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35718
Entity Detected:Ism1, isthmin 1 homolog (zebrafish) ( MGI:2442963)
Sequence:sense strand is shown

>T35718
AGAGCAGCCAGAGTATGATTCCACAGACGGGGAGGGTGATTGGAGTCTCTGGTCTGTCTGCAGCGTCACC
TGTGGAAATGGCAACCAGAAACGGACCCGTTCTTGTGGCTATGCATGCATTGCCACAGAATCCAGGACCT
GTGACCGTCCAAACTGCCCAGGAATTGAAGATACTTTCAGGACAGCGGCCACTGAAGTGAGTCTGCTTGC
GGGAAGTGAGGAGTTTAATGCCACCAAGTTGTTTGAAGTTGACATGGACAGCTGTGAGCGATGGATGAGC
TGCAAAAGTGAGTTCTTAAAGAAATACATGCACAAGGTGATCAACGACCTGCCCAGCTGCCCCTGCTCCT
ACCCTACTGAGGTGGCCTACAGCACAGCTGACATCTTTGACCGCATCAAGCGCAAGGACTTCCGATGGAA
GGATGCTAGTGGGCCCAAAGAGAAACTAGAGATCTACAAGCCTACTGCTCGGTACTGCATCCGCTCTATG
CTGTCCCTGGAGAGTACCACACTGGCTGCCCAGCACTGTTGCTATGGTGACAACATGCAGCTCATCACCA
GGGGCAAAGGGGCAGGCACTCCCAATCTCATCAGCACCGAGTTCTCTGCTGAACTCCACTACAAAGTGGA
TGTTCTGCCCTGGATTATCTGCAAGGGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 79743. Forward Primer - name:079743_F_cDNA_5430433G21Rik, sequence:AGAGCAGCCAGAGTATGATTCC; Reverse Primer - name:079743_N_SP6_cDNA_5430433G21Rik, sequence:CACCCTTGCAGATAATCCAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12067 same embryo
 EMAGE:12070 same embryo
 EMAGE:12071 same embryo
 EMAGE:12069 same embryo
 EMAGE:12068 same embryo
 EurExpress:euxassay_009556 same experiment
 MGI:4825632 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS