Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12431

Cadm2 cell adhesion molecule 2 ( MGI:2442722)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12431 EMAGE:12431 EMAGE:12431 EMAGE:12431 EMAGE:12431
"Pseudo-wholemount" of euxassay_011528. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011528_01 euxassay_011528_02 euxassay_011528_03 euxassay_011528_04
EMAGE:12431 EMAGE:12431 EMAGE:12431 EMAGE:12431 EMAGE:12431
euxassay_011528_05 euxassay_011528_06 euxassay_011528_07 euxassay_011528_08 euxassay_011528_09
EMAGE:12431 EMAGE:12431 EMAGE:12431 EMAGE:12431 EMAGE:12431
euxassay_011528_10 euxassay_011528_11 euxassay_011528_12 euxassay_011528_13 euxassay_011528_14
EMAGE:12431 EMAGE:12431 EMAGE:12431 EMAGE:12431 EMAGE:12431
euxassay_011528_15 euxassay_011528_16 euxassay_011528_17 euxassay_011528_18 euxassay_011528_19
EMAGE:12431 EMAGE:12431 EMAGE:12431
euxassay_011528_20 euxassay_011528_21 euxassay_011528_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12431Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12431_wholemount_strong.wlz
12431_wholemount_moderate.wlz
12431_wholemount_weak.wlz
12431_wholemount_possible.wlz
12431_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12431_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05
femur
moderate moderate
regionalmoderate expression: see section 20 21
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
weak weak
regionalweak expression: see section 03 04 05 18
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons mantle layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain
weak weak
regionalweak expression: see section 03
midbrain mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
trigeminal v ganglion
weak weak
homogeneousweak expression: see section 03 04 05 06 07 08 09 16 17 18 19 20 21 22
spinal cord mantle layer
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16
basioccipital bone
strong strong
regionalstrong expression: see section 19
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 19 20
orbito-sphenoid
strong strong
regionalstrong expression: see section 19
viscerocranium
strong strong
regionalExpression in the turbinate bone.
scapula
moderate moderate
regionalmoderate expression: see section 04 05
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37747
Entity Detected:Cadm2, cell adhesion molecule 2 ( MGI:2442722)
Sequence:sense strand is shown

>T37747
CTGTACCATCCATAATGCAGGACATTTCTTATTGCCTAAATTTTACACCATTGCTCTTTTAACATACAGT
GCTTGAATATACAGCCTTAACAATGTTAATCATCTCACTGGATCATGGTATTGAGTTGTTTTTATACATT
GAAGAAATGTATGCAGAGCCCCGCCCCTACATTTGTTTTTCTTGAAGTCATAGACTTTATTGGTTTGCCA
TTGGACAGTTATCACAAGTCACAGGATTAGGTGATGACCTAATGTGTTTAAGCTTAATCGAAGATTAGTG
GTTTACAAACAATGTTTTCTACCTGTCTATCTTCAAAGATAACATGTTGTGGAAACATACGCCCTAGAAA
ACACAAACTGAAAAAACATTGTAGTGTAGTTTGTGGAATGTTTGAGATTATACTGGTAATACTGTATCAA
GTGGCTATTTTAAAATTTAGTGTTTGATACAGGCGCCATGTGTATGGATTATACTCATGACATGACACCT
TATATTATTATATAGATCCTACCATTAGGTTATTGTAGCTTCATTTACCAATAAATTATTACAAACATTT
AACTGCTTTGGGAATCATAAAGATTTCATTCATTTCTCTATGTTGATTCTATAATTTATTTGTTCCATAA
GGATTCACCTGCCTAAACAAAACTGAAGTAGGGCACAATTTTGAGACA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88511. Forward Primer - name:088511_F_cDNA_Igsf4d, sequence:CTGTACCATCCATAATGCAGGA; Reverse Primer - name:088511_N_SP6_cDNA_Igsf4d, sequence:TGTCTCAAAATTGTGCCCTAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12432 same embryo
 EMAGE:12429 same embryo
 EMAGE:12430 same embryo
 EMAGE:12428 same embryo
 EurExpress:euxassay_011528 same experiment
 MGI:4823590 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS