Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12531

Clint1 clathrin interactor 1 ( MGI:2144243)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12531 EMAGE:12531 EMAGE:12531 EMAGE:12531 EMAGE:12531
"Pseudo-wholemount" of euxassay_011314. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011314_01 euxassay_011314_02 euxassay_011314_03 euxassay_011314_04
EMAGE:12531 EMAGE:12531 EMAGE:12531 EMAGE:12531 EMAGE:12531
euxassay_011314_05 euxassay_011314_06 euxassay_011314_07 euxassay_011314_08 euxassay_011314_09
EMAGE:12531 EMAGE:12531 EMAGE:12531 EMAGE:12531 EMAGE:12531
euxassay_011314_10 euxassay_011314_11 euxassay_011314_12 euxassay_011314_13 euxassay_011314_14
EMAGE:12531 EMAGE:12531 EMAGE:12531 EMAGE:12531 EMAGE:12531
euxassay_011314_15 euxassay_011314_16 euxassay_011314_17 euxassay_011314_18 euxassay_011314_19
EMAGE:12531 EMAGE:12531 EMAGE:12531 EMAGE:12531 EMAGE:12531
euxassay_011314_20 euxassay_011314_21 euxassay_011314_22 euxassay_011314_23 euxassay_011314_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12531Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12531_wholemount_strong.wlz
12531_wholemount_moderate.wlz
12531_wholemount_weak.wlz
12531_wholemount_possible.wlz
12531_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12531_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 05 06 11 17 18 moderate expression: see section 01 02 03 04 07 08 09 10 19 21 22 23 weak expression: see section 20
sublingual gland primordium
strong strong
regionalstrong expression: see section 11 18
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 19 20 21
otic capsule
strong strong
regionalstrong expression: see section 08 09 10 11 18 19
naris
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19
viscerocranium
strong strong
regionalExpression in the turbinate bone.
heart valve
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 11 12
rectum
strong strong
regionalstrong expression: see section 15
midgut
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 moderate expression: see section 10 11 12
mandible
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 15 17 18 19 20 21 22 23 moderate expression: see section 24
maxilla
strong strong
regionalstrong expression: see section 07 08 09 10 11 20 21 22 23 moderate expression: see section 24
liver
strong strong
regionalstrong expression: see section 01 02 03 05 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 04 08
renal cortex
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 18 19 20 21 22 23
cricoid cartilage
strong strong
regionalstrong expression: see section 15
thyroid cartilage
strong strong
regionalstrong expression: see section 14 15 16
basioccipital bone
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
strong strong
regionalstrong expression: see section 14
temporal bone
strong strong
regionalstrong expression: see section 02
temporal bone petrous part
strong strong
regionalstrong expression: see section 03 04 05 06 07 21 22 23 24
vault of skull
strong strong
regionalstrong expression: see section 02 03 04 05
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 21 22 23 24
clavicle
strong strong
regionalstrong expression: see section 10 11 12 18 19 moderate expression: see section 09
sternum
strong strong
regionalstrong expression: see section 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37550
Entity Detected:Clint1, clathrin interactor 1 ( MGI:2144243)
Sequence:sense strand is shown

>T37550
CCCATGTCCAGATCACAGAATACAGATATGGTCCAGAAGTCGGCCAGCAAAACCCTGCCCTCTACTTGGT
CTGACCCCAGTGTCAACATCAGCCTAGACAACTTACTACCTGGTATGCAGCCTTCCAAGCCCCAGCAGCC
ATCGCTTAATACAATGATTCAACAACAGAATATGCAACAGCCTCTGAATGTGATGACACAAAGCTTTGGA
GCTGTGAACCTCAGTTCTCCATCAAACATGCTTCCTGTCCGGCCTCAAACTAACCCTCTCCTGGGGGGAC
CCATGCCTATGAACATGCCCGGTGTAATGACGGGCACCATGGGAATGGCCCCTCTGGGGAACAGCGCAGG
GATGAGCCAGGGCATGGTGGGCATGAACATGAACATGGGGATGTCGGCCTCGGGGATGGGCTTGTCGGGC
ACCATGGGAATGGGCATGCCCAGCATGGCCATGCCTTCTGGAACTGTGCAACCCAAGCAAGATGCCTTTG
CAAACTTTGCCAACTTTAGCAAATAAAAGGTTGTAACGGAGCGAGTGGAAGAAGACTCTGTAACTGCAAT
AGGTGATGTTGGGATGGAAGATGCTAAGCAGTTCCCTTTTCTTTTATCAGTTAATTAAATAACCCACATA
AAGAACCAAAAAGGCTGGTGTTTCAGAAGCGATGCAAGAGCACTTCAGATGAGGCAGTCAGGATCGGTTT
CCCCAGTGAAGATACGCTCCAAATGGGGTGAGGGTCACGAGAGCCTCTCTGGGTCAGAGAGCCCATGTCA
CAGCGTAGTCTGTGGGAGGACTGGCACGGATGGGGCTGAGTGTGTGTGCTTCACTCTCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 83526. Forward Primer - name:083526_F_cDNA_AI642036, sequence:CCCATGTCCAGATCACAGAATA; Reverse Primer - name:083526_N_SP6_cDNA_AI642036, sequence:AGAGAGTGAAGCACACACACTCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12533 same embryo
 EMAGE:12530 same embryo
 EMAGE:12535 same embryo
 EMAGE:12534 same embryo
 EMAGE:12532 same embryo
 EurExpress:euxassay_011314 same experiment
 MGI:4823927 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS