Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12601

Dpy30 dpy-30 homolog (C. elegans) ( MGI:1913560)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12601 EMAGE:12601 EMAGE:12601 EMAGE:12601 EMAGE:12601
"Pseudo-wholemount" of euxassay_011324. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011324_01 euxassay_011324_02 euxassay_011324_03 euxassay_011324_04
EMAGE:12601 EMAGE:12601 EMAGE:12601 EMAGE:12601 EMAGE:12601
euxassay_011324_05 euxassay_011324_06 euxassay_011324_07 euxassay_011324_08 euxassay_011324_09
EMAGE:12601 EMAGE:12601 EMAGE:12601 EMAGE:12601 EMAGE:12601
euxassay_011324_10 euxassay_011324_11 euxassay_011324_12 euxassay_011324_13 euxassay_011324_14
EMAGE:12601 EMAGE:12601 EMAGE:12601 EMAGE:12601 EMAGE:12601
euxassay_011324_15 euxassay_011324_16 euxassay_011324_17 euxassay_011324_18 euxassay_011324_19
EMAGE:12601 EMAGE:12601 EMAGE:12601 EMAGE:12601
euxassay_011324_20 euxassay_011324_21 euxassay_011324_22 euxassay_011324_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12601Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12601_wholemount_strong.wlz
12601_wholemount_moderate.wlz
12601_wholemount_weak.wlz
12601_wholemount_possible.wlz
12601_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12601_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 16 17 18 19 20
pancreas
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 17 18 19
thyroid gland
moderate moderate
regionalmoderate expression: see section 12 13 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 14 15 16 17 18 moderate expression: see section 07 08 12 13
vomeronasal organ
strong strong
regionalstrong expression: see section 10 moderate expression: see section 13
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11
midgut
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
lower jaw molar
strong strong
regionalstrong expression: see section 18 moderate expression: see section 07 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 13 14
upper jaw molar
strong strong
regionalstrong expression: see section 18 moderate expression: see section 07 19
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
renal cortex
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 20 21 22 23
left lung
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
right lung
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30174
Entity Detected:Dpy30, dpy-30 homolog (C. elegans) ( MGI:1913560)
Sequence:sense strand is shown

>T30174
CAGGGCACTTAGGAACCGACAGCCTTGGCGCGGACTGGTATCCGGTTGATTGCGGTTTGCAGGGTCCGCC
ATGGAGTCGGAGCAGATGCTGGAGGGACAGACACAGGTTGCAGAAAACCCTCACTCTGAGTACGGACTCA
CAGACAGCGTTGAGAGAATAGTCGAAAATGAGAAGATTAATGCAGAAAAGTCATCGAAACAGAAGGTGGA
TCTACAGTCCTTGCCCACCCGTGCCTACCTGGACCAGACAGTTGTGCCTATCTTATTACAGGGACTTGCT
GTGCTTGCCAAGGAAAGACCACCAAATCCCATCGAGTTCCTAGCATCTTATCTTTTAAAAAACAAGGCGC
AGTTTGAAGATCGAAATTGATTTCTTGGGAAGAGAAGAAACATTTGGTTGCTACTGTAGATTTACATGAT
TACGAGGCAGCTTTAATTGCCATGATTCCCCTCCCCACTCTGGACGCCTAAGAACCTTCAGGACCACAGA
CCTCACTTCTGGAGTTGCAGAAGAGAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3491912), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 38443. Forward Primer - name:038443_F_IRAV04-07_E06_2810410M20Rik, sequence:CAGGGCACTTAGGAACCG; Reverse Primer - name:038443_R_SP6_IRAV04-07_E06_2810410M20Rik, sequence:TGCTCTCTTCTGCAACTCCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12598 same embryo
 EMAGE:12602 same embryo
 EMAGE:12600 same embryo
 EMAGE:12597 same embryo
 EMAGE:12599 same embryo
 EurExpress:euxassay_011324 same experiment
 MGI:4824389 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS