Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12658

Snx5 sorting nexin 5 ( MGI:1916428)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12658 EMAGE:12658 EMAGE:12658 EMAGE:12658 EMAGE:12658
"Pseudo-wholemount" of euxassay_011463. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011463_01 euxassay_011463_02 euxassay_011463_03 euxassay_011463_04
EMAGE:12658 EMAGE:12658 EMAGE:12658 EMAGE:12658 EMAGE:12658
euxassay_011463_05 euxassay_011463_06 euxassay_011463_07 euxassay_011463_08 euxassay_011463_09
EMAGE:12658 EMAGE:12658 EMAGE:12658 EMAGE:12658 EMAGE:12658
euxassay_011463_10 euxassay_011463_11 euxassay_011463_12 euxassay_011463_13 euxassay_011463_14
EMAGE:12658 EMAGE:12658 EMAGE:12658 EMAGE:12658 EMAGE:12658
euxassay_011463_15 euxassay_011463_16 euxassay_011463_17 euxassay_011463_18 euxassay_011463_19
EMAGE:12658 EMAGE:12658 EMAGE:12658
euxassay_011463_20 euxassay_011463_21 euxassay_011463_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12658Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12658_wholemount_strong.wlz
12658_wholemount_moderate.wlz
12658_wholemount_weak.wlz
12658_wholemount_possible.wlz
12658_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12658_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 18 19 20 21 22
thymus primordium
strong strong
regionalstrong expression: see section 13 14 15 16 17
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 18 19 20 21
pancreas
moderate moderate
regionalmoderate expression: see section 10 11 12 13 18
thyroid gland
strong strong
regionalstrong expression: see section 13 17
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 20 21 22
hypothalamus ventricular layer
moderate moderate
homogeneousmoderate expression: see section 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
homogeneousmoderate expression: see section 12 13 14
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 moderate expression: see section 12 17
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 moderate expression: see section 01 12 14 15 16 17 18 19 20 21 22
medulla oblongata floor plate
weak weak
regionalweak expression: see section 13
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 12 weak expression: see section 11 16 17 18
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 14 15
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 08 09 10 11 12 13 15 16 17 18 19 20 21
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 18 19 20 21 22
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 12 20 21 weak expression: see section 09 10 11 14 15 16 17 18 19
metencephalon roof
weak weak
regionalweak expression: see section 13
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 14 15 16
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 04 05 22
cornea epithelium
moderate moderate
regionalmoderate expression: see section 04 22
naris
weak weak
regionalweak expression: see section 12 13 15 16
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 09 10 11 12 13 15 16 17 18 19 20
esophagus
weak weak
regionalweak expression: see section 14 15
stomach
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 weak expression: see section 03
hindgut
strong strong
regionalstrong expression: see section 16 moderate expression: see section 15
midgut
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20 moderate expression: see section 09 10 11
mandible
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 weak expression: see section 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17 18
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 20 weak expression: see section 21
maxilla
moderate moderate
regionalmoderate expression: see section 08 09 18 19 20 21
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 20 21
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
bladder
weak weak
regionalExpression in the fundus region.
renal cortex
moderate moderate
regionalmoderate expression: see section 09 10 11 12 19 20 21 22
urethra of male
weak weak
regionalweak expression: see section 14 15 16
lung
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 06 07 08 21 22
trachea
weak weak
regionalweak expression: see section 14 15
exoccipital bone
moderate moderate
regionalmoderate expression: see section 04 05 22
temporal bone
moderate moderate
regionalmoderate expression: see section 04 05 22
orbito-sphenoid
strong strong
regionalstrong expression: see section 05 moderate expression: see section 03 04 06 19 22
clavicle
moderate moderate
regionalmoderate expression: see section 11 12 18 19 weak expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30175
Entity Detected:Snx5, sorting nexin 5 ( MGI:1916428)
Sequence:sense strand is shown

>T30175
ACCCATCGCTTCAGATCGACATACCTGATGCACTCAGTGAGAGAGATAAGGTCAAGTTTACAGTGCACAC
CAAGACCACACTGTCCACATTTCAGAGCCCAGAGTTTTCTGTTACAAGGCAACATGAAGACTTTGTGTGG
CTGCATGACACTCTTACTGAAACAACGGATTATGCTGGCCTTATTATCCCTCCTGCTCCTACAAAGCCAG
ACTTTGATGGCCCTCGAGAGAAGATGCAGAAACTGGGAGAAGGGGAAGGATCTATGACAAAAGAAGAGTT
TGCCAAGATGAAGCAAGAACTGGAAGCTGAGTATCTCGCTGTCTTTAAGAAGACTGTGTCCACCCATGAA
GTCTTTCTTCAGCGGCTTTCTTCTCACCCTGTTCTCAGTAAAGACCGCAACTTTCATGTTTTCTTGGAAT
ATGATCAGGATCTAAGTGTTAGACGGAAGAATACCAAGGAGATGTTTGGAGGCTTTTTTAAAAGTGTGGT
GAAGAGCGCCGATGAGGTCCTTTTTTCTGGAGTTAAGGAGGTGGATGACTTCTTTGAGCAAGAGAAGAAT
TTCCTTATTAACTATTACAACAGGATCAAGGATTCCTGTGCTAAAGCAGACAAAATGACCAGATCTCACA
AAAATGTTGCTGACGACTATATCCACACTGCAGCCTGCTTGCATAGCCTGGCCTTGGAAGAACCCACAGT
CATCAAAAAGTACCTGTTGAAAGTTGCAGAGCTATTTGAAAAACTTAGGAAAGTGGAAGGTCGAGTCTCA
TCAGATGAAGACTTAAAACTGACAGAGCTCCTCCGATACTACATGCTCAACATAGAGGCTGCAAAGGATC
TCTTGTATAGACGTACCAAAGCCCTAATTGACTATGAGAATTCAAACAAAGCTTTGGACAAGGCCCGGTT
AAAAAGCAAAGATGTCAAGTTGGCAGAGACTCATCAGCAGGAATGCTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3492262), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 13937. Forward Primer - name:013937_F_IRAV04-07_E22_Snx5, sequence:ACCCATCGCTTCAGATCG; Reverse Primer - name:013937_R_SP6_IRAV04-07_E22_Snx5, sequence:GGCAGCATTCCTGCTGAT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12662 same embryo
 EMAGE:12660 same embryo
 EMAGE:12659 same embryo
 EMAGE:12657 same embryo
 EMAGE:12661 same embryo
 EurExpress:euxassay_011463 same experiment
 MGI:4828369 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS