Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12705

Serinc5 serine incorporator 5 ( MGI:2444223)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12705 EMAGE:12705 EMAGE:12705 EMAGE:12705 EMAGE:12705
"Pseudo-wholemount" of euxassay_011506. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011506_01 euxassay_011506_02 euxassay_011506_03 euxassay_011506_04
EMAGE:12705 EMAGE:12705 EMAGE:12705 EMAGE:12705 EMAGE:12705
euxassay_011506_05 euxassay_011506_06 euxassay_011506_07 euxassay_011506_08 euxassay_011506_09
EMAGE:12705 EMAGE:12705 EMAGE:12705 EMAGE:12705 EMAGE:12705
euxassay_011506_10 euxassay_011506_11 euxassay_011506_12 euxassay_011506_13 euxassay_011506_14
EMAGE:12705 EMAGE:12705 EMAGE:12705 EMAGE:12705 EMAGE:12705
euxassay_011506_15 euxassay_011506_16 euxassay_011506_17 euxassay_011506_18 euxassay_011506_19
EMAGE:12705 EMAGE:12705 EMAGE:12705 EMAGE:12705
euxassay_011506_20 euxassay_011506_21 euxassay_011506_22 euxassay_011506_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12705Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12705_wholemount_strong.wlz
12705_wholemount_moderate.wlz
12705_wholemount_weak.wlz
12705_wholemount_possible.wlz
12705_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12705_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 05
forelimb digit 4 phalanx
strong strong
regionalstrong expression: see section 07 08
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 06
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 06 07
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 06 07
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 06 07 08 23
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 08 23
thyroid gland
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
vibrissa
strong strong
regionalstrong expression: see section 06 07 08 20 21 22 23
diencephalon floor plate
strong strong
regionalstrong expression: see section 12
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 12
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 16 17 18 moderate expression: see section 11
metencephalon floor plate
strong strong
regionalstrong expression: see section 12 13
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain floor plate
strong strong
regionalstrong expression: see section 11 12
spinal cord floor plate
strong strong
regionalstrong expression: see section 13 14
spinal cord mantle layer
strong strong
regionalstrong expression: see section 14 15 16
anterior naris
strong strong
spottedstrong expression: see section 13 14 16 17
lower jaw incisor
strong strong
regionalstrong expression: see section 13 16 17
lower jaw molar
strong strong
regionalstrong expression: see section 07 08 19 20
upper jaw incisor
strong strong
regionalstrong expression: see section 13 16 17
upper jaw molar
strong strong
regionalstrong expression: see section 07 08 19 20
clavicle
strong strong
regionalstrong expression: see section 09 10 11 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30375
Entity Detected:Serinc5, serine incorporator 5 ( MGI:2444223)
Sequence:sense strand is shown

>T30375
TGTTAGGGGCCATGTGCTCAGGAGCGTTCTTCATTCCGGATCAGGAGACCTTTCTGAAAGTCTGGCGCTA
TGTGGGAGCTGGGGGCAGCTTCCTCTTCATTTGTATCCAGCTCCTCCTGATTGTGCAGTTTGCACATAAG
TGGAACAAGAACTGGACTGCAGGCACCGTCCGTAATAAGCTGTGGTACGCCTCCCTGTCCCTGGTGACAC
TCATCATGTATTCCGTTGCTGTTGGAGGCTTGGCTTTGATGGCAGTGTTTTACACACAGTGGGACGACTG
CATGGACAACAAGATTCTCCTGGGAGTGCACGGTGGCCTATGCGTGCTAATCTCTCTGGTAGCCATCTCA
CCCTGCGTCCAGAATCGACAGCCACACTCTGGGCTGCTGCAGTCAGGGCTCATAAGCTGTTATGTCACCT
ACCTCACCTTCTCAGCACTGACCAGCAAGCCTGAAAAAAAAGTCCTGGATGAACATGGGAAGAATGTTAC
CATATGTGCGCCTGACTTTGGTCAAGACCTGCATAGAGATGAAAACATGGTGACTTGGCTGGGCACCCTT
CTTCTAATTGTGTGCATCTCATATTCATGTTTGACATCGACAACAAGGTCGAGCTCGGATGCTCTGCAGA
GTCGATACGGAGCGCCAGAGCTGGAAGTGGCCCGGTGCTGTTTCTGCTTTGGTCCAGATGGAGAAGACAC
TGAAGAGCAGCAGAACGTCAAGAAGGGACCCAGGGTGATTTATGATGAGAAGAAAGGCACCGTGTACAGC
TACTCCTATTTCCACTTCGTCTTCTTCCTGGCTTCCCTCTACGTGATGATGACTCTGACCAGCTGGTTCC
ACTATGAAAATGCCACCATTAAGACCTTCTTCTCAGGCTGGTCCGTCTTCTGGGTCAAGATGGCCTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6311617), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58233. Forward Primer - name:058233_F_IRAV101_h06_A130038L21Rik, sequence:TGTTAGGGGCCATGTGCT; Reverse Primer - name:058233_R_SP6_IRAV101_h06_A130038L21Rik, sequence:AGGAGGCCATCTTGACCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12704 same embryo
 EMAGE:12708 same embryo
 EMAGE:12703 same embryo
 EMAGE:12707 same embryo
 EMAGE:12706 same embryo
 EurExpress:euxassay_011506 same experiment
 MGI:4827970 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS