Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12708

Col9a1 collagen, type IX, alpha 1 ( MGI:88465)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12708 EMAGE:12708 EMAGE:12708 EMAGE:12708 EMAGE:12708
"Pseudo-wholemount" of euxassay_011520. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011520_01 euxassay_011520_02 euxassay_011520_03 euxassay_011520_04
EMAGE:12708 EMAGE:12708 EMAGE:12708 EMAGE:12708 EMAGE:12708
euxassay_011520_05 euxassay_011520_06 euxassay_011520_07 euxassay_011520_08 euxassay_011520_09
EMAGE:12708 EMAGE:12708 EMAGE:12708 EMAGE:12708 EMAGE:12708
euxassay_011520_10 euxassay_011520_11 euxassay_011520_12 euxassay_011520_13 euxassay_011520_14
EMAGE:12708 EMAGE:12708 EMAGE:12708 EMAGE:12708 EMAGE:12708
euxassay_011520_15 euxassay_011520_16 euxassay_011520_17 euxassay_011520_18 euxassay_011520_19
EMAGE:12708 EMAGE:12708 EMAGE:12708 EMAGE:12708
euxassay_011520_20 euxassay_011520_21 euxassay_011520_22 euxassay_011520_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12708Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12708_wholemount_strong.wlz
12708_wholemount_moderate.wlz
12708_wholemount_weak.wlz
12708_wholemount_possible.wlz
12708_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12708_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23
radius
strong strong
regionalstrong expression: see section 01 02
ulna
strong strong
regionalstrong expression: see section 01 02
humerus
strong strong
regionalstrong expression: see section 01 02 03 06 07 21 22 23 moderate expression: see section 04 05
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 06 07 08 09
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 23
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 23
forelimb digit 4 metacarpal
strong strong
regionalstrong expression: see section 03
forelimb digit 4 phalanx
strong strong
regionalstrong expression: see section 03 07 08
forelimb digit 5 metacarpal
strong strong
regionalstrong expression: see section 03
forelimb digit 5 phalanx
strong strong
regionalstrong expression: see section 03
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 06 07
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 07 08
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 06 07 23
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 06 07 08 23
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 06 23
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 06 07 08 09 10 23
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 06
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 06 07 08 09 10 23
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 07 08 09 10 23
fibula
strong strong
regionalstrong expression: see section 01 02 03 04
tibia
strong strong
regionalstrong expression: see section 01 02 03 04
femur
strong strong
regionalstrong expression: see section 08 09 22 23
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 19 21 weak expression: see section 11 20
otic capsule
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19
naris
strong strong
regionalstrong expression: see section 18
nasal septum
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
hyoid
strong strong
regionalstrong expression: see section 11 12 moderate expression: see section 14 15 16
mandible
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 18 19 20 21 22 23 moderate expression: see section 04 05
maxilla
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 18 19 20 21 22 23
bladder
moderate moderate
regionalmoderate expression: see section 13 14 15 16
cricoid cartilage
strong strong
regionalstrong expression: see section 12 13 15
thyroid cartilage
strong strong
regionalstrong expression: see section 12 13 14 15 16
trachea
strong strong
regionalstrong expression: see section 14 15
axial skeleton
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
exoccipital bone
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22 23
temporal bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 19 20 21 22 23
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 18 19 20 21 22 23
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
strong strong
regionalstrong expression: see section 08 09 10 11 17 18 19
scapula
strong strong
regionalstrong expression: see section 03 04 05 06 23
sternum
strong strong
regionalstrong expression: see section 14 15 16
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 10 11 12 18 19 20 21
axial skeleton tail region
strong strong
regionalstrong expression: see section 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30372
Entity Detected:Col9a1, collagen, type IX, alpha 1 ( MGI:88465)
Sequence:sense strand is shown

>T30372
AGAGGCCAGATTGATGCGGATGGCTTTGCAGTGCTGGGAAAACTTGTGGACAATCCTCAGGTTTCTGTTC
CTTTTGAACTCCAGTGGATGCTGATTCATTGTGACCCCCTGAGACCCAGGAGAGAAACCTGTCATGAGCT
GCCAATCAGAATCACAACCAGCCAGACCACTGATGAGAGAGGTCCTCCGGGTGAGCAGGGGCCTCCAGGG
CCTCCTGGGCCTCCTGGAGTTCCGGGCATAGATGGCATTGATGGTGACCGAGGTCCAAAGGGTCCCCCAG
GACCTCCGGGTCCTCCTGGAGACCCAGGCAAGCCAGGAGCACCAGGCAAGCCAGGCACACCAGGAGCTGA
TGGATTAACAGGACCTGATGGATCCCCTGGCTCTGTTGGACCAAGGGGACAAAAAGGAGAACCTGGTGTA
CCTGGGTCTCGTGGATTTCCAGGCCGTGGTATTCCAGGACCCCCTGGTCCTCCTGGGACCACAGGACTTC
CTGGAGAACTTGGCCGAGTAGGCCCTATTGGAGACCCTGGGAAAAGAGGACCACCTGGCCCTCCTGGACC
TCCAGGACCCAGTGGAACAATTGGATTTCATGATGGAGACCCATTGTGCCCCAATTCCTGCCCACCAGGT
CGCTCTGGATATCCAGGCCTACCAGGCATGAGGGGCCATAAAGGGGCGAAAGGAGAAATCGGCGAGCCAG
GAAGACAAGGACACAAGGGTGAAGAGGGTGACCAGGGGGAACTGGGAGAAGTTGGCGATCAAGGACCTCC
AGGACCTCAGGGTCTGAGAGGCATCACTGGCATAGTTGGAGACAAAGGAGAAAAGGGTGCTCGGGGATTT
GAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6314986), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58150. Forward Primer - name:058150_F_IRAV101_g08_Col9a1, sequence:AGAGGCCAGATTGATGCG; Reverse Primer - name:058150_R_SP6_IRAV101_g08_Col9a1, sequence:CATCAAATCCCCGAGCAC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12705 same embryo
 EMAGE:12704 same embryo
 EMAGE:12703 same embryo
 EMAGE:12707 same embryo
 EMAGE:12706 same embryo
 EurExpress:euxassay_011520 same experiment
 MGI:4823995 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS