Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13735

Mafb v-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian) ( MGI:104555)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13735 EMAGE:13735 EMAGE:13735 EMAGE:13735 EMAGE:13735
euxassay_019539_01 euxassay_019539_02 euxassay_019539_03 euxassay_019539_04 euxassay_019539_05
EMAGE:13735 EMAGE:13735 EMAGE:13735 EMAGE:13735 EMAGE:13735
euxassay_019539_06 euxassay_019539_07 euxassay_019539_08 euxassay_019539_09 euxassay_019539_10
EMAGE:13735 EMAGE:13735 EMAGE:13735 EMAGE:13735 EMAGE:13735
euxassay_019539_11 euxassay_019539_12 euxassay_019539_13 euxassay_019539_14 euxassay_019539_15
EMAGE:13735 EMAGE:13735 EMAGE:13735 EMAGE:13735 EMAGE:13735
euxassay_019539_16 euxassay_019539_17 euxassay_019539_18 euxassay_019539_19 euxassay_019539_20
EMAGE:13735 EMAGE:13735 EMAGE:13735 EMAGE:13735
euxassay_019539_21 euxassay_019539_22 euxassay_019539_23 euxassay_019539_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13735Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13735_wholemount_strong.wlz
13735_wholemount_moderate.wlz
13735_wholemount_weak.wlz
13735_wholemount_possible.wlz
13735_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13735_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
interdigital region between hindlimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 04 05 06
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 04 06 07
interdigital region between hindlimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 04 06 07 23
interdigital region between hindlimb digits 4 and 5
moderate moderate
regionalmoderate expression: see section 06 07 23
pancreas
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 15
vibrissa
weak weak
regionalweak expression: see section 06 07 08 21
olfactory cortex mantle layer
strong strong
regionalstrong expression: see section 10 11 12 15 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 12 18 19 21 weak expression: see section 11 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 22 23
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 19 20 21 22 23 weak expression: see section 05 06 24
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 10 11 21 moderate expression: see section 09 22 23
ventral grey horn
moderate moderate
regionalmoderate expression: see section 14 19 20 weak expression: see section 15 16 17
dorsal root ganglion
weak weak
regionalweak expression: see section 12 13 14 15 20 21 22
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 04
metanephros
strong strong
regionalstrong expression: see section 10 11 12 13 14 21 22 23 24
urethra of male
weak weak
regionalweak expression: see section 16 17
lung
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55100
Entity Detected:Mafb, v-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian) ( MGI:104555)
Sequence:sense strand is shown

>T55100
GACTCAGTTCGTCCCAGGAAGAGCAGAGGAGAGGAGAGGGACTCTGGAGTCCCCGTGGGCACGAGGCAAG
GCTGAGCTAAGGAAGGAAAAACAGACAGATCTGTCTGTCCAGAGTACGGAGAACACTGGCTCTCAGCCGG
AGACGCGGGCCTCAGTTAGGACTTTCGGCGCGCGAAGGAAAAAAAAAATCTCATCAGTTTTAATGCCTGC
TCGATTATATAGAAAAATACGAAAATCTGCATTAAAAATATTAATCCTGCATGCTGGACATGTATGGTAA
TAATTTCTATTTTGTACCATTTTCTTGTTTAACTTTAGCATGTTGTTGATCATGAATCATAACCCCCTTG
TTTCTTTGGGTGAGAAGGGATGCAGTTCCCAAACTCCTGCGGCTGCGAGCGAGCGAGCAGAGTTTCAGTC
GCCGGCCGGCTTGTAGATTACCCGCCCCGGCCAAACCATCTTGAGAAGGTAGCAGCAAGCTGAGTCTTTG
TTTGGGTTTATTATTATGCCATTTTTGTTTGTAAGTAAAAATAAAAGAAAGAAAAAACCCACCAAGCCCA
ACTTTGTCCGGGGAATCCTTGGGATTATCTCTTCGCCCCCCTCGTCCTTCCCACTTCAGTTTTAAGTTTT
GTTGAGGGAAAGCTAAGGGAGAGACAGATGCCGAGATCCACATCGTGCAGGAGTGTGTCCTTTATTATTG
TTGGGTCTTGGGGCCAAATTGACATACACACACCCACGACTGCTCCTCTACACACACACACACACACACA
CACACACACACACACACACACACACACACACACACACACACACGAAGAAAACAAGACAGGCTTTGCGTCC
TAAG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GACTCAGTTCGTCCCAGGAA; Reverse Primer - name:unspecified, sequence:CTTAGGACGCAAAGCCTGTC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13736 same embryo
 EMAGE:13732 same embryo
 EMAGE:13731 same embryo
 EMAGE:13734 same embryo
 EMAGE:13733 same embryo
 EurExpress:euxassay_019539 same experiment
 MGI:4826057 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS