Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13888

Deb1 differentially expressed in B16F10 1 ( MGI:1349474)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13888 EMAGE:13888 EMAGE:13888 EMAGE:13888 EMAGE:13888
"Pseudo-wholemount" of euxassay_007845. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007845_01 euxassay_007845_02 euxassay_007845_03 euxassay_007845_04
EMAGE:13888 EMAGE:13888 EMAGE:13888 EMAGE:13888 EMAGE:13888
euxassay_007845_05 euxassay_007845_06 euxassay_007845_07 euxassay_007845_08 euxassay_007845_09
EMAGE:13888 EMAGE:13888 EMAGE:13888 EMAGE:13888 EMAGE:13888
euxassay_007845_10 euxassay_007845_11 euxassay_007845_12 euxassay_007845_13 euxassay_007845_14
EMAGE:13888 EMAGE:13888 EMAGE:13888 EMAGE:13888 EMAGE:13888
euxassay_007845_15 euxassay_007845_16 euxassay_007845_17 euxassay_007845_18 euxassay_007845_19
EMAGE:13888 EMAGE:13888 EMAGE:13888
euxassay_007845_20 euxassay_007845_21 euxassay_007845_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13888Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13888_wholemount_strong.wlz
13888_wholemount_moderate.wlz
13888_wholemount_weak.wlz
13888_wholemount_possible.wlz
13888_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13888_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 05 06
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 16 moderate expression: see section 05 06 15
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 16 moderate expression: see section 05 06 15
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 15
fibula
strong strong
regionalstrong expression: see section 19 moderate expression: see section 03 04 17 18
tibia
strong strong
regionalstrong expression: see section 19 moderate expression: see section 02 03 04 17 18
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 15 16 17
otic capsule
moderate moderate
regionalmoderate expression: see section 07 08 15 16 weak expression: see section 17
nasal septum
strong strong
regionalstrong expression: see section 11 12 13
meckel's cartilage
strong strong
regionalstrong expression: see section 10 11 12 13
cricoid cartilage
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 11
thyroid cartilage
strong strong
regionalstrong expression: see section 10 13 moderate expression: see section 11 12
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 04 05 06
temporal bone
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 04 05 06 19 20
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 16 17 moderate expression: see section 03 04 05 06 10 13 18 19 20
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
strong strong
regionalstrong expression: see section 09 15 moderate expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1391
Entity Detected:Deb1, differentially expressed in B16F10 1 ( MGI:1349474)
Sequence:sense strand is shown

>T1391
CTCGAGCCTGTTGGCCTACTGGAGCTTTTTTTTTTTTTTGCAGCATGTCTGTCATCTTCGCTCCTGACTG
GCTACGCGGCAAAGCCAAGGTCAATCAAGAGACAATCCAGCGGCTCCTGGAGGAGAATGACCAGCTGATC
CGCTGTATCGTGGAGTATCAGAATAAGGGCCGAGCGAACGAGTGCGTCCAGTATCAGCATGTGTTACATA
GAAATCTCATTTATTTAGCTACCATCGCAGACGCCAACACAAGCAGTCTCACAAAGGCAGTGGAGTAGTT
TTCCAGAAGGCTGTAATGAGGACTGATTGGAACCCATCTCCTGGGAATCAGAGAGCTGCTCAGAACATGG
GCAAAAAGTCCCATTCATTTTAGACTGTGAAGAAACTCGCTACCAACTCTACTGTATTCTGACTATAAAT
ATTTATTAATAAAACAGATCCCACGGTAGAACCTGAGGACCTGCGAGGACCTGAGGTGTATGACAGCGGT
GTCATTGTCAACAATAGTGATTATCTGATGACATGTAATAAATGATACACGTCCGTCAAAAAAAAAAAAA
AA
Notes:The probe template was PCR amplified from IMAGE:2352742 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2352742 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13889 same embryo
 EMAGE:13887 same embryo
 EurExpress:euxassay_007845 same experiment
 MGI:4824276 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS