Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14870

Tfap2b transcription factor AP-2 beta ( MGI:104672)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14870 EMAGE:14870 EMAGE:14870 EMAGE:14870 EMAGE:14870
"Pseudo-wholemount" of euxassay_007906. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007906_01 euxassay_007906_02 euxassay_007906_03 euxassay_007906_04
EMAGE:14870 EMAGE:14870 EMAGE:14870 EMAGE:14870 EMAGE:14870
euxassay_007906_05 euxassay_007906_06 euxassay_007906_07 euxassay_007906_08 euxassay_007906_09
EMAGE:14870 EMAGE:14870 EMAGE:14870 EMAGE:14870 EMAGE:14870
euxassay_007906_10 euxassay_007906_11 euxassay_007906_12 euxassay_007906_13 euxassay_007906_14
EMAGE:14870 EMAGE:14870 EMAGE:14870 EMAGE:14870 EMAGE:14870
euxassay_007906_15 euxassay_007906_16 euxassay_007906_17 euxassay_007906_18 euxassay_007906_19
EMAGE:14870
euxassay_007906_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14870Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14870_wholemount_strong.wlz
14870_wholemount_moderate.wlz
14870_wholemount_weak.wlz
14870_wholemount_possible.wlz
14870_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14870_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand
moderate moderate
regionalmoderate expression: see section 01 04 05 19
foot
moderate moderate
regionalmoderate expression: see section 01 02 04 05
submandibular gland primordium
strong strong
regionalstrong expression: see section 04 05 16 moderate expression: see section 06 07 14 15
skin
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 01 02 03
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 weak expression: see section 17
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 15 16 weak expression: see section 17
pons mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 14 15
midbrain mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16
spinal cord mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 06 12 weak expression: see section 11
cervical ganglion
moderate moderate
regionalmoderate expression: see section 05 06 13
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 11
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 19 20
cornea epithelium
strong strong
regionalstrong expression: see section 01 04 moderate expression: see section 02 03 20
nasal cavity
strong strong
regionalstrong expression: see section 08 09 12 13 14 15 16 17 moderate expression: see section 10 11
lower jaw molar
strong strong
regionalstrong expression: see section 05 06 17
upper jaw molar
strong strong
regionalstrong expression: see section 05 06 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35549
Entity Detected:Tfap2b, transcription factor AP-2 beta ( MGI:104672)
Sequence:sense strand is shown

>T35549
AAGACGTGCAGTCAGTTGAAGATGCCAATAACAGCGGCATGAACCTATTGGACCAGTCAGTCATTAAAAA
AGTTCCTGTCCCTCCCAAATCTGTGACTTCTCTAATGATGAATAAAGATGGCTTCTTGGGAGGAATGTCA
GTCAACACCGGCGAGGTATTTTGCTCAGTCCCGGGCCGTTTATCTCTACTCAGTTCAACTTCAAAGTACA
AAGTCACTGTGGGCGAAGTTCAGAGAAGGCTCTCGCCCCCTGAATGCCTCAATGCATCTCTCCTGGGCGG
CGTCCTCAGAAGAGCCAAATCGAAAAATGGGGGGAGATCTTTGAGAGAAAGGCTAGAAAAAATCGGTTTG
AATTTACCCGCGGGCAGGCGCAAAGCAGCAAATGTCACGTTACTCACCTCACTGGTAGAAGGGGAAGCTG
TTCACTTAGCTCGGGATTTCGGGTATATTTGTGAAACAGAGTTTCCTGCTAAAGCCGTGTCCGAGTATTT
GAACAGACAGCACACGGACCCCAGTGACCTGCACTCCAGGAAGAATATGCTGCTGGCCACCAAGCAACTT
TGTAAAGAATTTACGGATCTGCTGGCTCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100959. Forward Primer - name:100959_F_cDNA_Tcfap2b, sequence:AAGACGTGCAGTCAGTTGAAGA; Reverse Primer - name:100959_N_SP6_cDNA_Tcfap2b, sequence:CTGAGCCAGCAGATCCGTAAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14867 same embryo
 EMAGE:14866 same embryo
 EMAGE:14868 same embryo
 EMAGE:14869 same embryo
 EMAGE:14865 same embryo
 EurExpress:euxassay_007906 same experiment
 MGI:4828639 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS