Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15256

Irx2 Iroquois related homeobox 2 (Drosophila) ( MGI:1197526)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15256 EMAGE:15256 EMAGE:15256 EMAGE:15256 EMAGE:15256
"Pseudo-wholemount" of euxassay_010444. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010444_01 euxassay_010444_02 euxassay_010444_03 euxassay_010444_04
EMAGE:15256 EMAGE:15256 EMAGE:15256 EMAGE:15256 EMAGE:15256
euxassay_010444_05 euxassay_010444_06 euxassay_010444_07 euxassay_010444_08 euxassay_010444_09
EMAGE:15256 EMAGE:15256 EMAGE:15256 EMAGE:15256 EMAGE:15256
euxassay_010444_10 euxassay_010444_11 euxassay_010444_12 euxassay_010444_13 euxassay_010444_14
EMAGE:15256 EMAGE:15256 EMAGE:15256 EMAGE:15256 EMAGE:15256
euxassay_010444_15 euxassay_010444_16 euxassay_010444_17 euxassay_010444_18 euxassay_010444_19
EMAGE:15256 EMAGE:15256 EMAGE:15256 EMAGE:15256 EMAGE:15256
euxassay_010444_20 euxassay_010444_21 euxassay_010444_22 euxassay_010444_23 euxassay_010444_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15256Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15256_wholemount_strong.wlz
15256_wholemount_moderate.wlz
15256_wholemount_weak.wlz
15256_wholemount_possible.wlz
15256_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15256_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 03 04 21 22
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 03 04 21 22
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 03 04 21 22
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 04 05 21 22
hindlimb digit 5 metatarsal
weak weak
regionalweak expression: see section 04 05 21
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 19 20 21 22 not examined expression: see section 23
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 14 15 16
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 14 15
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 17 18 19
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 20 moderate expression: see section 05 06 07 08 09 10 11 12 14 15 16 17 18 19 21
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 15 16 17 18
pons marginal layer
moderate moderate
regionalmoderate expression: see section 07
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 09 10 13 14 15 16 17 18
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 16 17 18 19 weak expression: see section 08 09 10 11 12 13 14 15
ventral grey horn
weak weak
regionalweak expression: see section 09 10 11 12 13 14
inner ear vestibular component
moderate moderate
regionalmoderate expression: see section 05 06 07 08 16 17 18 19
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23 weak expression: see section 24
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14
lower jaw molar
strong strong
regionalstrong expression: see section 06 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
upper jaw molar
strong strong
regionalstrong expression: see section 06 19 moderate expression: see section 18
metanephros
moderate moderate
regionalmoderate expression: see section 07 17
urethra of male
strong strong
regionalstrong expression: see section 13
lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
axial skeleton cervical region
weak weak
regionalweak expression: see section 06 07 16
axial skeleton lumbar region
weak weak
regionalweak expression: see section 08 09 14
axial skeleton sacral region
weak weak
regionalweak expression: see section 10 15
axial skeleton thoracic region
weak weak
regionalweak expression: see section 05 06 07 08 09 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30205
Entity Detected:Irx2, Iroquois related homeobox 2 (Drosophila) ( MGI:1197526)
Sequence:sense strand is shown

>T30205
CCTTGTGCGAATCAGGCTCAGAGTGTAAGGACAAGTTTGAGGACCTGGAGGACGAGGAGGACGAGGAAGA
CGAGTGCGAGCGGGACCTGGCGCCACCCAAGCCCGTAACCTCCTCGCCTCTCACCGGCGTGGAGGCACCC
CTGCTGAGCCCGGCGCCCGAAGCCGCGCCGCGCGGTGGCAGCGGTGGCAAGACGCCCCTAGGCAGCCGGA
CGTCGCCAGGAGCGCCGCCGCCCGCCAGCAAACCCAAGCTGTGGTCGCTGGCCGAGATAGCCACGTCGGA
CCTCAAGCAACCAAGCTTGGGCCCGGGTTGCGGGCCTCCGGGGCTGCCTGCTGCCGCCGCGCCTGCCTCG
ACTGGGGCCCCTCCGGGAGGCTCGCCCTACTCTGCTTCGCCCCTGCTGGGCCGCCACCTCTATTACACGT
CCCCTTTCTATGGCAACTACACAAACTACGGGAACTTAAACGCAGCGCTGCAAGGCCAGGGCCTTCTGCG
GTACAATACCGCGGCCTCCTCACCAGGCGAGACACTGCACGCCATGCCCAAGGCGGCCAGCGACACGGGC
AAGGCGGGCTCGCATTCACTGGAGTCCCACTACAGGCCTCCGGGCGGCGGCTACGAGCCCAAGAAAGATA
CCAGTGAGGGCTGTGCAGTTGTTGGTGCAGGCGTCCAGACCTACCTATAGGAGGGCCAAGGTCAGCAGTG
CAAGTAGGTGTCACAATTGCTTTGGAAAAAAAAGTCAGGAGGCTATTCTCCCTTCCCAAGTTCATAAATA
CACAGATACAAACCCCAGATGTGGAAACCCGGACCACATTTTGTGCCACTGTATAAGAGGATGCACACTG
CACTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3592499), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 21565. Forward Primer - name:021565_F_IRAV51-54_F21_Irx2, sequence:CCTTGTGCGAATCAGGCT; Reverse Primer - name:021565_R_SP6_IRAV51-54_F21_Irx2, sequence:GCAGTGCAGTGTGCATCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15254 same embryo
 EMAGE:15257 same embryo
 EMAGE:15253 same embryo
 EMAGE:15255 same embryo
 EMAGE:15252 same embryo
 EurExpress:euxassay_010444 same experiment
 MGI:4825623 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS