Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15258

Itga3 integrin alpha 3 ( MGI:96602)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15258 EMAGE:15258 EMAGE:15258 EMAGE:15258 EMAGE:15258
"Pseudo-wholemount" of euxassay_010457. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010457_01 euxassay_010457_02 euxassay_010457_03 euxassay_010457_04
EMAGE:15258 EMAGE:15258 EMAGE:15258 EMAGE:15258 EMAGE:15258
euxassay_010457_05 euxassay_010457_06 euxassay_010457_07 euxassay_010457_08 euxassay_010457_09
EMAGE:15258 EMAGE:15258 EMAGE:15258 EMAGE:15258 EMAGE:15258
euxassay_010457_10 euxassay_010457_11 euxassay_010457_12 euxassay_010457_13 euxassay_010457_14
EMAGE:15258 EMAGE:15258 EMAGE:15258 EMAGE:15258 EMAGE:15258
euxassay_010457_15 euxassay_010457_16 euxassay_010457_17 euxassay_010457_18 euxassay_010457_19
EMAGE:15258 EMAGE:15258 EMAGE:15258 EMAGE:15258 EMAGE:15258
euxassay_010457_20 euxassay_010457_21 euxassay_010457_22 euxassay_010457_23 euxassay_010457_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15258Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15258_wholemount_strong.wlz
15258_wholemount_moderate.wlz
15258_wholemount_weak.wlz
15258_wholemount_possible.wlz
15258_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15258_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
peritoneal component
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
sublingual gland primordium
moderate moderate
regionalmoderate expression: see section 10 17
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 17 18 19 20
thyroid gland
moderate moderate
regionalmoderate expression: see section 11 14 15 weak expression: see section 10
epidermis
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
weak weak
regionalweak expression: see section 06 07 08 09 21 22 23 24
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
ventral grey horn
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 18
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 23 24 weak expression: see section 06 21 22
cornea epithelium
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 24
naris
weak weak
regionalweak expression: see section 13 14 15 16 18
esophagus
weak weak
regionalweak expression: see section 12 13
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17 18
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 19 weak expression: see section 20
oral epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 21 22 weak expression: see section 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 weak expression: see section 20
bladder
weak weak
regionalExpression in the fundus region.
male reproductive system
weak weak
regionalweak expression: see section 14 15
urethra of male
weak weak
regionalweak expression: see section 15 16
lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 18 19 20 21 22 23 weak expression: see section 16 17 24
trachea
weak weak
regionalweak expression: see section 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30566
Entity Detected:Itga3, integrin alpha 3 ( MGI:96602)
Sequence:sense strand is shown

>T30566
CTCAACCAGGCACAGGCTATGGAGAATCACACTGAGGTCCACTTCCAGAAAGAGTGCGGGCCAGACAACA
AGTGCGACAGCAACCTGCAGATGCGAGCAGCCTTCCTGTCTGAGCAGCTGCAGCCTCTAAGCAGGCTCCA
GTACAGCAGAGACACTAAGAAACTGTTTTTGAGCATCAATGTGACCAATTCACCGAGCAGCCAACGGGCT
GGGGAAGATGCGCATGAGGCATTGCTCACCCTAGAGGTGCCATCCGCCCTGCTACTGTCCTCCGTGCGCC
CGTCTGGGACCTGCCAAGCTAATAACGAGACCATCCTGTGTGAGCTAGGAAACCCCTTCAAACGGAACCA
GAGGATGGAGCTGCTCATTGCCTTTGAGGTCATCGGGGTAACGTTGCACACGAGGGACCTCCCAGTACTT
CTTCAGCTGTCCACGTCGAGTCACCAGGACAACTTGCAGCCCGTACTCCTGACTTTGCAGGTGGACTACA
CCCTCCAGGCCTCGCTCAGCTTAATGAATCATCGGTTGCAGAGCTTCTTTGGTGGCACAGTGATGGGTGA
GGCTGCCATGAAAACTGCGGAGGATGTGGGAAGTCCCCTGAAATATGAATTCCAGGTGAGCCCAGTGGGA
GATGGGCTGGCAGCCTTGGGCACACTGGTTCTAGGTCTGGAGTGGCCCTATGAAGTTACCAATGGCAAGT
GGCTGCTGTACCCCACGGAGATCACCATCCATAGCAATGGTTCCTGGCCCTGCCAGCCGTCTGGAAACCT
TGTCAACCCTCTCAACCTTACTCTCTCTGACCCTGGAGTCACACCACTGTCGCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6401146), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59004. Forward Primer - name:059004_F_IRAV112_c01_Itga3, sequence:CTCAACCAGGCACAGGCT; Reverse Primer - name:059004_R_SP6_IRAV112_c01_Itga3, sequence:GTGGCGACAGTGGTGTGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15260 same embryo
 EMAGE:15262 same embryo
 EMAGE:15259 same embryo
 EMAGE:15263 same embryo
 EMAGE:15261 same embryo
 EurExpress:euxassay_010457 same experiment
 MGI:4825641 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS