Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15267

Bmp4 bone morphogenetic protein 4 ( MGI:88180)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15267 EMAGE:15267 EMAGE:15267 EMAGE:15267 EMAGE:15267
"Pseudo-wholemount" of euxassay_010368. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010368_01 euxassay_010368_02 euxassay_010368_03 euxassay_010368_04
EMAGE:15267 EMAGE:15267 EMAGE:15267 EMAGE:15267 EMAGE:15267
euxassay_010368_05 euxassay_010368_06 euxassay_010368_07 euxassay_010368_08 euxassay_010368_09
EMAGE:15267 EMAGE:15267 EMAGE:15267 EMAGE:15267 EMAGE:15267
euxassay_010368_10 euxassay_010368_11 euxassay_010368_12 euxassay_010368_13 euxassay_010368_14
EMAGE:15267 EMAGE:15267 EMAGE:15267 EMAGE:15267 EMAGE:15267
euxassay_010368_15 euxassay_010368_16 euxassay_010368_17 euxassay_010368_18 euxassay_010368_19
EMAGE:15267 EMAGE:15267 EMAGE:15267 EMAGE:15267
euxassay_010368_20 euxassay_010368_21 euxassay_010368_22 euxassay_010368_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15267Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15267_wholemount_strong.wlz
15267_wholemount_moderate.wlz
15267_wholemount_weak.wlz
15267_wholemount_possible.wlz
15267_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15267_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 07 moderate expression: see section 08 09 10 21 22 23
pineal primordium
strong strong
regionalstrong expression: see section 10 11
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 04 06 07 08 09 10 11 12 13 14
cochlea
strong strong
regionalstrong expression: see section 05 06 13 14 15
utricle
strong strong
regionalstrong expression: see section 02 03 04 16 17
eyelid
strong strong
regionalstrong expression: see section 05
anterior naris
strong strong
regionalstrong expression: see section 14 15 16 17 18 19
external naris
strong strong
regionalstrong expression: see section 14 15 19
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 18 19 20
aorta
strong strong
regionalstrong expression: see section 09 10 11 12
pulmonary artery
strong strong
regionalstrong expression: see section 09 10 11
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 moderate expression: see section 01
rectum
strong strong
regionalstrong expression: see section 13 14
midgut
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
left lung
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10
right lung
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30231
Entity Detected:Bmp4, bone morphogenetic protein 4 ( MGI:88180)
Sequence:sense strand is shown

>T30231
CCTGCAGCGATCCAGTCTCTGGCCCTCGACCAGGTTCATTGCAGCTGTCTAGAGGTCCCCAGAAGCAGCT
GCTGGCGAGCCCGCTTCTGCAGGAACCAATGAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCGT
TTTATTATGCCAAGTCCTGCTAGGAGGCGCGAGCCATGCTAGTTTGATACCTGAGACCGGGAAGAAAAAA
GTCGCCGAGATTCAGGGCCACGCGGGAGGACGCCGCTCAGGGCAGAGCCATGAGCTCCTGCGGGACTTCG
AGGCGACACTTCTACAGATGTTTGGGCTGCGCCGCCGTCCGCAGCCTAGCAAGAGCGCCGTCATTCCGGA
TTACATGAGGGATCTTTACCGGCTCCAGTCTGGGGAGGAGGAGGAGGAAGAGCAGAGCCAGGGAACCGGG
CTTGAGTACCCGGAGCGTCCCGCCAGCCGAGCCAACACTGTGAGGAGTTTCCATCACGAAGAACATCTGG
AGAACATCCCAGGGACCAGTGAGAGCTCTGCTTTTCGTTTCCTCTTCAACCTCAGCAGCATCCCAGAAAA
TGAGGTGATCTCCTCGGCAGAGCTCCGGCTCTTTCGGGAGCAGGTGGACCAGGGCCCTGACTGGGAACAG
GGCTTCCACCGTATAAACATTTATGAGGTTATGAAGCCCCCAGCAGAAATGGTTCCTGGACACCTCATCA
CACGACTACTGGACACCAGACTAGTCCATCACAATGTGACACGGTGGGAAACTTTCGATGTGAGCCCTGC
AGTCCTTCGCTGGACCCGGGAAAAGCAACCCAATTATGGGCTGGCCATTGAGGTGACTCACCTCCACCAG
ACACGGACCCACCAGGGCCAGCATGTCAGAATCAGCCGATCGTTACCTCAAGGGAGTGGAGATTGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4192158), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 26206. Forward Primer - name:026206_F_IRAV59-62_H07_Bmp4, sequence:CCTGCAGCGATCCAGTCT; Reverse Primer - name:026206_R_SP6_IRAV59-62_H07_Bmp4, sequence:GCCCAATCTCCACTCCCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15265 same embryo
 EMAGE:15268 same embryo
 EMAGE:15266 same embryo
 EMAGE:15264 same embryo
 EMAGE:15269 same embryo
 EurExpress:euxassay_010368 same experiment
 MGI:4823485 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS