Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15521

Herc1 hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 ( MGI:2384589)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15521 EMAGE:15521 EMAGE:15521 EMAGE:15521 EMAGE:15521
"Pseudo-wholemount" of euxassay_010717. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010717_01 euxassay_010717_02 euxassay_010717_03 euxassay_010717_04
EMAGE:15521 EMAGE:15521 EMAGE:15521 EMAGE:15521 EMAGE:15521
euxassay_010717_05 euxassay_010717_06 euxassay_010717_07 euxassay_010717_08 euxassay_010717_09
EMAGE:15521 EMAGE:15521 EMAGE:15521 EMAGE:15521 EMAGE:15521
euxassay_010717_10 euxassay_010717_11 euxassay_010717_12 euxassay_010717_13 euxassay_010717_14
EMAGE:15521 EMAGE:15521 EMAGE:15521 EMAGE:15521 EMAGE:15521
euxassay_010717_15 euxassay_010717_16 euxassay_010717_17 euxassay_010717_18 euxassay_010717_19
EMAGE:15521 EMAGE:15521 EMAGE:15521 EMAGE:15521
euxassay_010717_20 euxassay_010717_21 euxassay_010717_22 euxassay_010717_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15521Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15521_wholemount_strong.wlz
15521_wholemount_moderate.wlz
15521_wholemount_weak.wlz
15521_wholemount_possible.wlz
15521_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15521_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 13 14 weak expression: see section 12 15
brain
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
moderate moderate
regionalmoderate expression: see section 08 09 10 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 19 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 17 18 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 17 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10 11 18
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 14 15
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 15 16 17
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 05
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 17 18 19 20 21
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 14 17 18 19
mandible
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 16 17 18 19 20 21 22 23 weak expression: see section 12
maxilla
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 19 20 21 22 weak expression: see section 12
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31222
Entity Detected:Herc1, hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 ( MGI:2384589)
Sequence:sense strand is shown

>T31222
CCGACCCACGTACGAACTAATGGCTGAAGAGTAAATCAACATGGCGACTATGGTTCCACCAGTGAAACTG
AAATGGCTTGAACACCTGAATAGCTCCTGGATCACAGAGGACAGTGAATCTATTGCTACAAGAGAGGGAG
TTACCGTTTTGTATTCTAAACTGATCAGCAATAAGGAAGTAGTACCTTTGCCTCAACAGGTTTTATGCCT
CAAAGGACCACAGTTGCCTGATTTTGAACGTGAGTCTCTTTCAAGTGATGAGCAGGACCATTATTTGGAT
GCCCTTCTTAGCAGCCAGCTAGCACTAGCAAAGATGGTATGTTCAGATTCTCCATTTGCTGGGGCGCTAA
GAAAACGACTGCTTGTACTCCAACGTGTCTTTTATGCACTTTCTAATAAGTACCATGACAAAGGCAAAGT
GAAACAGCAGCAGCATTCTCCGGAGAGCAGCTCTGGTTCAGCAGATGTCCATTCTGTCAGTGAACGCCCC
CGGTCAAGCACTGATGCACTTATAGAAATGGGTGTCCGAACTGGTCTAAGTTTGTTATTTGCACTTCTGA
GACAGAGTTGGATGATGCCTGTGTCGGGACCTGGCCTCAGTCTCTGCAACGACGTTATTCATACTGCAAT
TGAAGTTGTGAGCTCTTTGCCTCCATTGTCTTTAGCAAATGAAAGCAAGATTCCTCCTATGGGCTTGGAC
TGCTTATCACAAGTCACAACATTTCTTAAAGGAGTAACTATTCCCAATTCTGGGGCAGACACTTTAGGTC
GTCGATTAGCTTCTGAGTTGCTGCTTGGCTTAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3494753), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 14067. Forward Primer - name:014067_F_IRAV04-07_M12_Herc1, sequence:CCGACCCACGTACGAACT; Reverse Primer - name:014067_R_SP6_IRAV04-07_M12_Herc1, sequence:TGCTAAGCCAAGCAGCAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15522 same embryo
 EMAGE:15518 same embryo
 EMAGE:15520 same embryo
 EMAGE:15519 same embryo
 EurExpress:euxassay_010717 same experiment
 MGI:4825355 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS