Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16122

Has3 hyaluronan synthase 3 ( MGI:109599)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16122 EMAGE:16122 EMAGE:16122 EMAGE:16122 EMAGE:16122
"Pseudo-wholemount" of euxassay_013542. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013542_01 euxassay_013542_02 euxassay_013542_03 euxassay_013542_04
EMAGE:16122 EMAGE:16122 EMAGE:16122 EMAGE:16122 EMAGE:16122
euxassay_013542_05 euxassay_013542_06 euxassay_013542_07 euxassay_013542_08 euxassay_013542_09
EMAGE:16122 EMAGE:16122 EMAGE:16122 EMAGE:16122 EMAGE:16122
euxassay_013542_10 euxassay_013542_11 euxassay_013542_12 euxassay_013542_13 euxassay_013542_14
EMAGE:16122 EMAGE:16122 EMAGE:16122 EMAGE:16122 EMAGE:16122
euxassay_013542_15 euxassay_013542_16 euxassay_013542_17 euxassay_013542_18 euxassay_013542_19
EMAGE:16122 EMAGE:16122 EMAGE:16122
euxassay_013542_20 euxassay_013542_21 euxassay_013542_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16122Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16122_wholemount_strong.wlz
16122_wholemount_moderate.wlz
16122_wholemount_weak.wlz
16122_wholemount_possible.wlz
16122_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16122_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 17 weak expression: see section 06
vibrissa
strong strong
regionalstrong expression: see section 07 08 09 10 11 21 22
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 08 11 13 15 16
lateral ventricle
moderate moderate
regionalmoderate expression: see section 05
telencephalon mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 17 18 moderate expression: see section 03 04 10 19 20 21 22 weak expression: see section 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 13 14
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 08 13 14 15 16
spinal cord lateral wall
weak weak
regionalweak expression: see section 10
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 11 weak expression: see section 08 09 12 13
cochlea
moderate moderate
regionalmoderate expression: see section 06 07 15 16
utricle
moderate moderate
regionalmoderate expression: see section 05 17
anterior naris epithelium
strong strong
regionalstrong expression: see section 13 14 17 moderate expression: see section 15 16
external naris epithelium
strong strong
regionalstrong expression: see section 13 14 17 moderate expression: see section 18
naso-lacrimal duct
moderate moderate
regionalmoderate expression: see section 10 18 weak expression: see section 19
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 08 18
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13 17
upper jaw molar
strong strong
regionalstrong expression: see section 07 18 moderate expression: see section 19
metanephros
moderate moderate
regionalmoderate expression: see section 06 07 08 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45088
Entity Detected:Has3, hyaluronan synthase 3 ( MGI:109599)
Sequence:sense strand is shown

>T45088
CAGAAACAAGCAATGACAGCTCATAGAATATATCCTCCTAGCCCAGCTGAACATGACAAGGAGTTCCTGT
CAAGTGTTACTGTCCCATACCGGCTACTGTCCCATTTCCCTAACCTCCGATTAGCCATCAATGCGTTAAG
ACTGTGCCTGAGATAATGAGGCTGGGAAGCTGACCTTTGGTCAAAAAACAGGGTCTAAGAAATGGTGCTT
TATGTAATTAATATATTCCACTCCACACCAAAACATCCCAGGGATGAGCCAAGTCACCAGAAGTAAGGAA
TGAGTCTGGTGGGGATTTTATCTGTTTTGGGTGCACAGTACAAAGCAAAGTCTGCAATGCACCAAACAAA
AGCCGCCCAGTTGTTCTGCTGCACATTTGTCATCCCAGCACTTAGAAGCAGAAAGAGATGAGAGGGTCAG
GGTTAGGCTAGACTACATGAGATCCTGACTGTCTCATACAAAAATGGTTTGACGGAGGATCAAAGATTGC
GTTGGTGCTAAAAACCATGGATGCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 233182. Forward Primer - name:233182_F_exon_Has3, sequence:CAGAAACAAGCAATGACAGCTC; Reverse Primer - name:233182_N_SP6_exon_Has3, sequence:AGGCATCCATGGTTTTTAGCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16124 same embryo
 EMAGE:16126 same embryo
 EMAGE:16121 same embryo
 EMAGE:16125 same embryo
 EMAGE:16123 same embryo
 EurExpress:euxassay_013542 same experiment
 MGI:4825323 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS