Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16248

Ptch1 patched homolog 1 ( MGI:105373)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16248 EMAGE:16248 EMAGE:16248 EMAGE:16248 EMAGE:16248
"Pseudo-wholemount" of euxassay_017091. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_017091_01 euxassay_017091_02 euxassay_017091_03 euxassay_017091_04
EMAGE:16248 EMAGE:16248 EMAGE:16248 EMAGE:16248 EMAGE:16248
euxassay_017091_05 euxassay_017091_06 euxassay_017091_07 euxassay_017091_08 euxassay_017091_09
EMAGE:16248 EMAGE:16248 EMAGE:16248 EMAGE:16248 EMAGE:16248
euxassay_017091_10 euxassay_017091_11 euxassay_017091_12 euxassay_017091_13 euxassay_017091_14
EMAGE:16248 EMAGE:16248 EMAGE:16248 EMAGE:16248 EMAGE:16248
euxassay_017091_15 euxassay_017091_16 euxassay_017091_17 euxassay_017091_18 euxassay_017091_19
EMAGE:16248 EMAGE:16248 EMAGE:16248 EMAGE:16248 EMAGE:16248
euxassay_017091_20 euxassay_017091_21 euxassay_017091_22 euxassay_017091_23 euxassay_017091_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16248Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16248_wholemount_strong.wlz
16248_wholemount_moderate.wlz
16248_wholemount_weak.wlz
16248_wholemount_possible.wlz
16248_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16248_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 02 03 04 23 moderate expression: see section 01 05 06 07 18 19 21 22 24 weak expression: see section 17 20
radius
weak weak
regionalweak expression: see section 01 02 03 04
ulna
weak weak
regionalweak expression: see section 01
humerus
weak weak
regionalweak expression: see section 02 03 04 22 23
forelimb digit 1 phalanx
weak weak
regionalweak expression: see section 07
forelimb digit 2 phalanx
weak weak
regionalweak expression: see section 07 08 09 23 24
forelimb digit 3 phalanx
weak weak
regionalweak expression: see section 07 08 09 23 24
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 06
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 12 13 14 weak expression: see section 05 06 15 16 17
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 12 13 14 weak expression: see section 05 15 16 17
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 15 16 17
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 15 16
foot mesenchyme
weak weak
regionalweak expression: see section 09 10
fibula
moderate moderate
regionalmoderate expression: see section 06 07 08
tibia
moderate moderate
regionalmoderate expression: see section 07 08
femur
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 07
vibrissa
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 20 21 22 23
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 13 moderate expression: see section 12 14 15
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 19 weak expression: see section 18
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 10 11 moderate expression: see section 12 13 14
pons ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 moderate expression: see section 08 12 14 15 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 moderate expression: see section 12 14 15 16 weak expression: see section 08
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 11 12
esophagus
strong strong
regionalstrong expression: see section 12
stomach
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12
hindgut
moderate moderate
regionalmoderate expression: see section 16 17 18
midgut
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21 weak expression: see section 22 23 24
mandible
moderate moderate
regionalmoderate expression: see section 03 04 05 18 19 21 22 23 weak expression: see section 06 07 08 09 10 11 16 17 20
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 15 16 17
maxilla
moderate moderate
regionalmoderate expression: see section 18 19 20 21 22 23 weak expression: see section 05 06 07 08 09 10 11 16 17
upper jaw incisor
weak weak
regionalweak expression: see section 12 14 15 16 17
bladder
moderate moderate
regionalmoderate expression: see section 15 16 17
male reproductive system
weak weak
regionalweak expression: see section 12 13 14 17
urethra of male
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 17
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
axial skeleton
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 08 09 10 14 15 16
basioccipital bone
moderate moderate
regionalmoderate expression: see section 12 13 14 weak expression: see section 10 11 15
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 12 weak expression: see section 11 14 15
clavicle
moderate moderate
regionalmoderate expression: see section 08 09 17 weak expression: see section 07 16 18
scapula
weak weak
regionalweak expression: see section 02 03 20 21 22 23
pelvic girdle skeleton
weak weak
regionalweak expression: see section 11 12 19 20
tail skeleton
weak weak
regionalweak expression: see section 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63072
Entity Detected:Ptch1, patched homolog 1 ( MGI:105373)
Sequence:sense strand is shown

>T63072
AAGCCCATCGACATTAGTCAGTTGACTAAACAGCGTCTGGTAGACGCAGATGGCATCATTAATCCGAGCG
CTTTCTACATCTACCTGACCGCTTGGGTCAGCAACGACCCTGTAGCTTACGCTGCCTCCCAGGCCAACAT
CCGGCCTCACCGGCCGGAGTGGGTCCATGACAAAGCCGACTACATGCCAGAGACCAGGCTGAGAATCCCA
GCAGCAGAGCCCATCGAGTACGCTCAGTTCCCTTTCTACCTCAACGGCCTACGAGACACCTCAGACTTTG
TGGAAGCCATAGAAAAAGTGAGAGTCATCTGTAACAACTATACGAGCCTGGGACTGTCCAGCTACCCCAA
TGGCTACCCCTTCCTGTTCTGGGAGCAATACATCAGCCTGCGCCACTGGCTGCTGCTATCCATCAGCGTG
GTGCTGGCCTGCACGTTTCTAGTGTGCGCAGTCTTCCTCCTGAACCCCTGGACGGCCGGGATCATTGTCA
TGGTCCTGGCTCTGATGACCGTTGAGCTCTTTGGCATGATGGGCCTCATTGGGATCAAGCTGAGTGCTGT
GCCTGTGGTCATCCTGATTGCATCTGTTGGCATCGGAGTGGAGTTCACCGTCCACGTGGCTTTGGCCTTT
CTGACAGCCATTGGGGACAAGAACCACAGGGCTATGCTCGCTCTGGAACACATGTTTGCTCCCGTTCTGG
ACGGTGCTGTGTCCACTCTGCTGGGTGTACTGATGCTTGCAGGGTCCGAATTTGATTTCATTGTCAGATA
CTTCTTTGCCGTCCTGGCCATTCTCACCGTCTTGGGGGTTCTCAATGGACT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98399. Forward Primer - name:098399_F_cDNA_Ptch1, sequence:AAGCCCATCGACATTAGTCAGT; Reverse Primer - name:098399_N_SP6_cDNA_Ptch1, sequence:AGTCCATTGAGAACCCCCAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16251 same embryo
 EMAGE:16252 same embryo
 EMAGE:16250 same embryo
 EMAGE:16247 same embryo
 EMAGE:16249 same embryo
 EurExpress:euxassay_017091 same experiment
 MGI:4827498 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS