Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17349

Tyms thymidylate synthase ( MGI:98878)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17349 EMAGE:17349 EMAGE:17349 EMAGE:17349 EMAGE:17349
"Pseudo-wholemount" of euxassay_008886. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008886_01 euxassay_008886_02 euxassay_008886_03 euxassay_008886_04
EMAGE:17349 EMAGE:17349 EMAGE:17349 EMAGE:17349 EMAGE:17349
euxassay_008886_05 euxassay_008886_06 euxassay_008886_07 euxassay_008886_08 euxassay_008886_09
EMAGE:17349 EMAGE:17349 EMAGE:17349 EMAGE:17349 EMAGE:17349
euxassay_008886_10 euxassay_008886_11 euxassay_008886_12 euxassay_008886_13 euxassay_008886_14
EMAGE:17349 EMAGE:17349 EMAGE:17349 EMAGE:17349 EMAGE:17349
euxassay_008886_15 euxassay_008886_16 euxassay_008886_17 euxassay_008886_18 euxassay_008886_19
EMAGE:17349 EMAGE:17349 EMAGE:17349 EMAGE:17349 EMAGE:17349
euxassay_008886_20 euxassay_008886_21 euxassay_008886_22 euxassay_008886_23 euxassay_008886_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17349Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17349_wholemount_strong.wlz
17349_wholemount_moderate.wlz
17349_wholemount_weak.wlz
17349_wholemount_possible.wlz
17349_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17349_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
limb
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 24
gland
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
visceral organ system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
integumental system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 15 16 17 18 19 20 21
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 15 16 17 18 19 20 21
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
sensory organ system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cardiovascular system
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tail
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T7022
Entity Detected:Tyms, thymidylate synthase ( MGI:98878)
Sequence:sense strand is shown

>T7022
AAAGGTCCTGGTTTTGTCGCTAACTACACTGCTGTCGTACTGCTCCGTTATGCTGGTGGTTGGCTCCGAG
CTGCAGTCCGATGCTCAGCAGCTGAGCGCGGAAGCCCCGCAGCATGGAGAACTCCAGTACCTGAGGCAGG
TGGAACACATTTTGCGCTGCGGCTTCAAGAAGGAGGACCGCACGGGCACAGGCACCCTGTCGGTGTTCGG
CATGCAGGCACGATACAGCCTGAGAGATGAATTTCCTCTGCTCACAACCAAACGAGTGTTCTGGAAGGGT
GTTTTGGAGGAGTTGTTGTGGTTTATCAAGGGATCCACAAATGCTAAAGAATTGTCCTCCAAGGGAGTGA
GAATCTGGGATGCCAATGGATCCCGAGATTTTCTGGACAGCTTGGGATTTTCTGCCCGACAGGAAGGGGA
CCTGGGCCCAGTTTATGGTTTCCAATGGAGGCATTTTGGAGCAGAGTACAAAGATATGGATTCAGATTAC
TCGGGACAAGGAGTAGACCAGCTGCAAAAAGTGATTGACACCATCAAAACCAACCCTGATGACAGAAGAA
TCATCATGTGTGCCTGGAACCCAAAAGATCTTCCCCTGATGGCACTGCCTCCTTGCCATGCCCTCTGTCA
GTTCTATGTGGTGAATGGGGAACTGTCTTGCCAGCTTTACCAGAGGTCAGGAGATATGGGTCTGGGCGTG
CCCTTCAACATTGCCAGCTATGCTCTGCTCACCTACATGATTGCACATATCACAGGCCTGCAGCCAGGTG
ATTTTGTCCACACTTTGGGAGATGCACATATTTACCTGAATCATATAGAGCCGCTGAAAATTCAGCTACA
GCGAGAACCAAGACCTTTCCCAAAGCTCAAAATCCTTCGAAAAGTTGAGACAATCGATGATTTCAAAGTT
GAAGACTTTCAGATTGAAGGGTATAATCCACATCCAACGATTAAAATGGAAATGGCTGTTTAAAAAAAAA
AAAAAA
Notes:The probe template was PCR amplified from IMAGE:3994204 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3994204 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17351 same embryo
 EMAGE:17350 same embryo
 EurExpress:euxassay_008886 same experiment
 MGI:4829038 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS