Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17968

Gm22 predicted gene 22 ( MGI:2684868)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17968 EMAGE:17968 EMAGE:17968 EMAGE:17968 EMAGE:17968
"Pseudo-wholemount" of euxassay_011722. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011722_01 euxassay_011722_02 euxassay_011722_03 euxassay_011722_04
EMAGE:17968 EMAGE:17968 EMAGE:17968 EMAGE:17968 EMAGE:17968
euxassay_011722_05 euxassay_011722_06 euxassay_011722_07 euxassay_011722_08 euxassay_011722_09
EMAGE:17968 EMAGE:17968 EMAGE:17968 EMAGE:17968 EMAGE:17968
euxassay_011722_10 euxassay_011722_11 euxassay_011722_12 euxassay_011722_13 euxassay_011722_14
EMAGE:17968 EMAGE:17968 EMAGE:17968 EMAGE:17968 EMAGE:17968
euxassay_011722_15 euxassay_011722_16 euxassay_011722_17 euxassay_011722_18 euxassay_011722_19
EMAGE:17968 EMAGE:17968 EMAGE:17968 EMAGE:17968 EMAGE:17968
euxassay_011722_20 euxassay_011722_21 euxassay_011722_22 euxassay_011722_23 euxassay_011722_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17968Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17968_wholemount_strong.wlz
17968_wholemount_moderate.wlz
17968_wholemount_weak.wlz
17968_wholemount_possible.wlz
17968_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17968_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 23 24
radius
moderate moderate
regionalmoderate expression: see section 01 24
ulna
moderate moderate
regionalmoderate expression: see section 01 24
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 23 24
forelimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 03 04
forelimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 03 04
forelimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 03 04
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 03 04
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 03 04
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 03 04
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 03 04
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 04
tarsus
moderate moderate
regionalmoderate expression: see section 03 04
fibula
moderate moderate
regionalmoderate expression: see section 01 02 24
tibia
moderate moderate
regionalmoderate expression: see section 01 02 24
femur
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 19 20 21
otic capsule
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 18
naris
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
nasal septum
moderate moderate
regionalmoderate expression: see section 13
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
mandible
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15
maxilla
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 13 15 16 17 18 19 20
bladder
moderate moderate
regionalmoderate expression: see section 12 13 14
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
basioccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 20 21 22 23 24
vault of skull
moderate moderate
regionalmoderate expression: see section 01 02 03 04 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 19 20 21 22 23 24
clavicle
moderate moderate
regionalmoderate expression: see section 07 08 09 15 16
scapula
moderate moderate
regionalmoderate expression: see section 02 03 04
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 09
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37724
Entity Detected:Gm22, predicted gene 22 ( MGI:2684868)
Sequence:sense strand is shown

>T37724
GAGAAAGCCATGGAAGACAAAGGAAGGGCCAGGCCCTGGGACTGGGCAGACATGGAAGCGTGGGAAACAC
TGGGAAAGCCCCCTTGGCCCCCGACAAGTCATCCAGGGCCCCCCGAAAGCAAGCAACTCCCAGCCGAGTT
CCCCCTGTCAAGTCGAGACCCAGTGGCCAGAGCAGCAGGGCAAGGCCACAGCCATCAGCACAGCGGAAAG
GGGATCCAGGCCACACTTCAGAAAAGGGCTCTTTGCCCCAGGCAAGAGCCCTGTCCAGGCCCTACAAAAG
GGTCAGAGCTCTCCATGTCAGTGGTGTTGCGCCTATGGAGCCCCGAGACCGCCGGACTGCAGAAGCCCAG
AGCGACCTCCTCAGTCAGCTGTTTGGGCAGAAGCTGACCAGCTTCAGAATCCCTCTGAAGAAGGACAGTT
CCCAGTGACCCAAAAGAGAGGATGCGTGGGTGCCCGGCTGATGGGCTTCTGTCTGGCCTCCAGCATTGGA
GACAGCTCCCTGGTAGACCCACTGCCTGTTTCTCTGCACCTGAGTTTCCAGATTCGAGGCCTGAGAACAG
GGCTTTGGCTGGAAGGCTGGGAAGGACCGGTCTCTACCGCCCAGGGATCACCTGCTTCCCTAGTGTCAAG
TACTTGAAGAGAGCAGGTTGCATCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 81603. Forward Primer - name:081603_F_cDNA_Gm22, sequence:GAGAAAGCCATGGAAGACAAAG; Reverse Primer - name:081603_N_SP6_cDNA_Gm22, sequence:GGATGCAACCTGCTCTCTTCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17965 same embryo
 EMAGE:17967 same embryo
 EMAGE:17966 same embryo
 EurExpress:euxassay_011722 same experiment
 MGI:4825094 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS