Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18025

Tln1 talin 1 ( MGI:1099832)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18025 EMAGE:18025 EMAGE:18025 EMAGE:18025 EMAGE:18025
"Pseudo-wholemount" of euxassay_011794. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011794_01 euxassay_011794_02 euxassay_011794_03 euxassay_011794_04
EMAGE:18025 EMAGE:18025 EMAGE:18025 EMAGE:18025 EMAGE:18025
euxassay_011794_05 euxassay_011794_06 euxassay_011794_07 euxassay_011794_08 euxassay_011794_09
EMAGE:18025 EMAGE:18025 EMAGE:18025 EMAGE:18025 EMAGE:18025
euxassay_011794_10 euxassay_011794_11 euxassay_011794_12 euxassay_011794_13 euxassay_011794_14
EMAGE:18025 EMAGE:18025 EMAGE:18025
euxassay_011794_15 euxassay_011794_16 euxassay_011794_17

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18025Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18025_wholemount_strong.wlz
18025_wholemount_moderate.wlz
18025_wholemount_weak.wlz
18025_wholemount_possible.wlz
18025_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18025_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
limb
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
gland
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
visceral organ system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
nervous system
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 16 17 moderate expression: see section 10 11 12 14 15
integumental system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
sensory organ system
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 16 17 moderate expression: see section 10 11 12 14 15
cardiovascular system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
skeleton
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
tail
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37140
Entity Detected:Tln1, talin 1 ( MGI:1099832)
Sequence:sense strand is shown

>T37140
AACCACAGAGCACATACGTCAGGAACTGGCGGTCTTCTGTTCCCCAGAGCCACCTGCCAAGACCTCTACC
CCTGAAGACTTCATCCGAATGACCAAGGGTATTACTATGGCAACAGCCAAAGCCGTTGCTGCTGGCAATT
CCTGTCGACAGGAAGATGTCATTGCCACAGCCAATCTGAGCCGACGGGCTATTGCGGACATGCTTCGGGC
TTGCAAGGAAGCAGCTTTCCACCCAGAAGTGGCGCCTGATGTACGGCTCCGAGCCCTGCACTATGGCCGG
GAGTGTGCCAATGGTTACCTGGAACTGCTGGACCACGTGCTGCTGACCCTTCAGAAGCCAAACCCAGACC
TGAAGCAGCAGCTAACTGGACACTCAAAGCGGGTTGCTGGCTCTGTGACTGAGCTCATCCAGGCTGCTGA
AGCCATGAAAGGAACAGAGTGGGTGGACCCAGAGGACCCTACTGTCATTGCTGAGAATGAGCTCTTGGGA
GCCGCAGCCGCCATCGAGGCTGCAGCCAAGAAGCTGGAGCAGCTGAAGCCCAGGGCCAAACCCAAGGAGG
CGGATGAGTCCTTGAACTTTGAGGAACAAATCCTAGAAGCTGCCAAGTCCATCGCTGCAGCCACCAGTGC
ACTGGTAAAGGCTGCGTCAGCAGCCCAGAGGGAGCTGGTGGCTCAAGGAAAGGTGGGCGCCATTCCAGCC
AATGCACTGGATGATGGGCAGTGGTCGCAGGGCCTCATTTCCGCTGCCCGTATGGTGGCTGCGGCCACCA
ACAATCTGTGTGAAGCAGCTAACGCAGCTGTCCAGGGCCATGCTAGCCAGGAGAAACTCATTTCCTCAGC
CAAGCAAGTAGCTGCCTCCACAGCTCAGCTCCTGGTAGCTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99509. Forward Primer - name:099509_F_cDNA_Tln1, sequence:AACCACAGAGCACATACGTCAG; Reverse Primer - name:099509_N_SP6_cDNA_Tln1, sequence:AAGCTACCAGGAGCTGAGCTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18028 same embryo
 EMAGE:18026 same embryo
 EMAGE:18023 same embryo
 EMAGE:18027 same embryo
 EMAGE:18024 same embryo
 EurExpress:euxassay_011794 same experiment
 MGI:4828739 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS