Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18276

Pde1b phosphodiesterase 1B, Ca2+-calmodulin dependent ( MGI:97523)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18276 EMAGE:18276 EMAGE:18276 EMAGE:18276 EMAGE:18276
"Pseudo-wholemount" of euxassay_012073. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012073_01 euxassay_012073_02 euxassay_012073_03 euxassay_012073_04
EMAGE:18276 EMAGE:18276 EMAGE:18276 EMAGE:18276 EMAGE:18276
euxassay_012073_05 euxassay_012073_06 euxassay_012073_07 euxassay_012073_08 euxassay_012073_09
EMAGE:18276 EMAGE:18276 EMAGE:18276 EMAGE:18276 EMAGE:18276
euxassay_012073_10 euxassay_012073_11 euxassay_012073_12 euxassay_012073_13 euxassay_012073_14
EMAGE:18276 EMAGE:18276 EMAGE:18276 EMAGE:18276 EMAGE:18276
euxassay_012073_15 euxassay_012073_16 euxassay_012073_17 euxassay_012073_18 euxassay_012073_19
EMAGE:18276 EMAGE:18276 EMAGE:18276 EMAGE:18276 EMAGE:18276
euxassay_012073_20 euxassay_012073_21 euxassay_012073_22 euxassay_012073_23 euxassay_012073_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18276Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18276_wholemount_strong.wlz
18276_wholemount_moderate.wlz
18276_wholemount_weak.wlz
18276_wholemount_possible.wlz
18276_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18276_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 04 05 06 weak expression: see section 03 07 16 17 18 19 20 21
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 weak expression: see section 20 21 22 23 24
femur
moderate moderate
regionalmoderate expression: see section 20 21 weak expression: see section 03 04 05 06 07 17 18 19
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 16 17 18 19 20 weak expression: see section 09 10 11 12 13 14 21 22 23
neural retina
moderate moderate
regionalmoderate expression: see section 23 24 weak expression: see section 03 04 05
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 05 09 10 11 12 13 16 21 weak expression: see section 04 07 08
basioccipital bone
weak weak
regionalweak expression: see section 13 14
basisphenoid bone
weak weak
regionalweak expression: see section 13 14
exoccipital bone
weak weak
regionalweak expression: see section 03 04 05 19 20 21 22 23 24
temporal bone
weak weak
regionalweak expression: see section 01 02 03 04 05 19 20 21 22
vault of skull
weak weak
regionalweak expression: see section 01 02 03
orbito-sphenoid
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 20 21 22 23
viscerocranium
weak weak
regionalExpression in the turbinate bone.
scapula
weak weak
regionalweak expression: see section 03 04 19 20
pelvic girdle skeleton
weak weak
regionalweak expression: see section 08 09 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30695
Entity Detected:Pde1b, phosphodiesterase 1B, Ca2+-calmodulin dependent ( MGI:97523)
Sequence:sense strand is shown

>T30695
GCAGACAGTGGCTGAGCATGGAGCTGTCCCCCCGCAGTCCTCCAGAGATGCTGGAGTCGGATTGCCCGTC
ACCCCTGGAGCTGAAGTCAGCCCCCAGCAAGAAAATGTGGATTAAGCTACGGTCTCTGCTGCGCTACATG
GTGAAGCAGTTGGAGAATGGGGAGGTTAACATCGAGGAGCTGAAGAAAAACCTGGAATACACAGCTTCCC
TGCTGGAAGCTGTCTACATTGATGAGACAAGGCAAATCCTAGACACTGAAGATGAGCTTCGGGAACTTCG
GTCAGATGCTGTGCCTTCAGAGGTGCGGGACTGGTTGGCCTCCACCTTCACCCAGCAGACCCGAGCCAAA
GGTCGCAGGGCAGAAGAGAAACCCAAGTTCCGAAGCATCGTGCATGCTGTGCAGGCTGGGATCTTCGTGG
AGCGGATGTTCCGGAGAACGTATACCTCTGTGGGCCCCACATACTCTACTGCAGTCCACAACTGTCTCAA
GAACCTGGACCTCTGGTGCTTTGATGTCTTTTCCTTGAACCGGGCAGCCGATGACCACGCTCTGAGGACC
ATTGTTTTTGAGTTGCTGACTCGGCATAGCCTCATCAGCCGCTTTAAGATTCCCACAGTGTTTCTGATGA
GTTTTCTGGAGGCCTTGGAGACAGGCTATGGGAAATATAAGAATCCTTACCACAACCAGATCCACGCAGC
CGACGTGACCCAGACTGTCCATTGCTTCCTTCTCCGCACAGGCATGGTGCACTGCCTGTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6826674), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59756. Forward Primer - name:059756_F_IRAV118_e08_Pde1b, sequence:GCAGACAGTGGCTGAGCA; Reverse Primer - name:059756_R_SP6_IRAV118_e08_Pde1b, sequence:TGACAGGCAGTGCACCAT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18278 same embryo
 EMAGE:18277 same embryo
 EMAGE:18275 same embryo
 EMAGE:18279 same embryo
 EurExpress:euxassay_012073 same experiment
 MGI:4827117 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS