Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18294

Bhlhb9 basic helix-loop-helix domain containing, class B9 ( MGI:1917487)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18294 EMAGE:18294 EMAGE:18294 EMAGE:18294 EMAGE:18294
"Pseudo-wholemount" of euxassay_012088. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012088_01 euxassay_012088_02 euxassay_012088_03 euxassay_012088_04
EMAGE:18294 EMAGE:18294 EMAGE:18294 EMAGE:18294 EMAGE:18294
euxassay_012088_05 euxassay_012088_06 euxassay_012088_07 euxassay_012088_08 euxassay_012088_09
EMAGE:18294 EMAGE:18294 EMAGE:18294 EMAGE:18294 EMAGE:18294
euxassay_012088_10 euxassay_012088_11 euxassay_012088_12 euxassay_012088_13 euxassay_012088_14
EMAGE:18294 EMAGE:18294 EMAGE:18294 EMAGE:18294 EMAGE:18294
euxassay_012088_15 euxassay_012088_16 euxassay_012088_17 euxassay_012088_18 euxassay_012088_19
EMAGE:18294 EMAGE:18294 EMAGE:18294 EMAGE:18294 EMAGE:18294
euxassay_012088_20 euxassay_012088_21 euxassay_012088_22 euxassay_012088_23 euxassay_012088_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18294Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18294_wholemount_strong.wlz
18294_wholemount_moderate.wlz
18294_wholemount_weak.wlz
18294_wholemount_possible.wlz
18294_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18294_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 05 06 07 08 15 16
humerus
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 04 05
fibula
moderate moderate
regionalmoderate expression: see section 01
tibia
moderate moderate
regionalmoderate expression: see section 01 02
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 17 18 19 weak expression: see section 08 09
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 18 19 20 21 weak expression: see section 16 17
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 17
trigeminal v nerve
weak weak
regionalweak expression: see section 09 16
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 15 17 18 weak expression: see section 16
otic capsule
weak weak
regionalweak expression: see section 08 09 16
neural retina
weak weak
regionalweak expression: see section 01 02 03 22 23 24
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 05 06 07 08 weak expression: see section 03 04 09 11 13 14 15
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 weak expression: see section 12 15 16
basioccipital bone
moderate moderate
regionalmoderate expression: see section 10 11 13 14 weak expression: see section 09 12 15 16
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 10 11 13 14 weak expression: see section 12
exoccipital bone
strong strong
regionalstrong expression: see section 02 moderate expression: see section 01 03 05 06 weak expression: see section 04 07
temporal bone
strong strong
regionalstrong expression: see section 02 moderate expression: see section 01 03 05 06 weak expression: see section 04
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 moderate expression: see section 01 03 05 06
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
scapula
weak weak
regionalweak expression: see section 04 05
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 09 10 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30710
Entity Detected:Bhlhb9, basic helix-loop-helix domain containing, class B9 ( MGI:1917487)
Sequence:sense strand is shown

>T30710
ATCCAGGCTCGTGCTGAGGAGCCCGCACCTAGGACCAGCCACAAGTCTAGGTCAGGTGCTGAGGAGGAGG
AGGAAGAGAACGTTATTGGGAACTGGTTTTGGGAAGGCGATGACACTGGTTTTGATACTGATCCTAAACC
TGTGTTCAAAATAGTTAAACCTCAGCCAGTGGATGAAATTAATGAAAAAGATAGGCCAAAGGACTGGTCC
GAGGTAACTATATGGCCCAAAGCTCCTGCTGTAACTCCAGCAGTGTTAGGTTATAGATCCCAGGATTCAT
CTGAGGCAAGGTCCTCTTCATACATTGTTCTGGCCTCAAATGAAGAGGAAACTTCAACAGCCTGTACTAA
GAATACTCGTTCAAGCCTACAGTCTATACCTGAGTATCCATTTGGTTCTGATCCTTGCATCCAGACCTTA
GATGAAATTAGACAGCAAATCAAGATCAGAGAAGAGAATGGCATCAAGCCCTTCGCTTGCCCTTGCAAAC
TGGAGTGCTATTTGGATTCTCCAGAATTTGAAAAGCTTGTTAACATACTTAAGTCAACTACTGATCCTCT
TATTCATAAAATAGCACAGATTGCAATGGGTATACATAAGGTTCATCCATTTGCCCAGGAATTCATTAAT
GAAGTGGGCGTGGTGACACTTATTGAAAGCTTGCTCAGTTTTTCTTCCCCTGAGGTTAGTATTAAAAAGG
CTGTGATTACTCTGAACTCTTCCGGGGATGACAGATACAACAAGGTAGAGTTTCATGTTAAGCATATGTG
TAAAGAAACTGTGTCCTTCCCCTTGAACTCACCTGGCCAGCAATCTGGATTAAAGATAATAGGGCAGCTG
ACTACCGAGTCTGTCCATCACTACATTGTAGTCAGCTACTTTTCAGAGCTTTTCCATTTGCTGTCTCAGG
GAAATCGTAAGACTAGGAATCTTGTTTTGAAAGTATTTTTGAATATGTCTGAAAATCCCAAGGCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6809364), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60383. Forward Primer - name:060383_F_IRAV119_d02_2700087I09Rik, sequence:ATCCAGGCTCGTGCTGAG; Reverse Primer - name:060383_R_SP6_IRAV119_d02_2700087I09Rik, sequence:GCTGCCTTGGGATTTTCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18296 same embryo
 EMAGE:18298 same embryo
 EMAGE:18297 same embryo
 EMAGE:18293 same embryo
 EMAGE:18295 same embryo
 EurExpress:euxassay_012088 same experiment
 MGI:4823466 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS