Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18415

Brpf3 bromodomain and PHD finger containing, 3 ( MGI:2146836)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18415 EMAGE:18415 EMAGE:18415 EMAGE:18415 EMAGE:18415
"Pseudo-wholemount" of euxassay_014369. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014369_01 euxassay_014369_02 euxassay_014369_03 euxassay_014369_04
EMAGE:18415 EMAGE:18415 EMAGE:18415 EMAGE:18415 EMAGE:18415
euxassay_014369_05 euxassay_014369_06 euxassay_014369_07 euxassay_014369_08 euxassay_014369_09
EMAGE:18415 EMAGE:18415 EMAGE:18415 EMAGE:18415 EMAGE:18415
euxassay_014369_10 euxassay_014369_11 euxassay_014369_12 euxassay_014369_13 euxassay_014369_14
EMAGE:18415 EMAGE:18415 EMAGE:18415 EMAGE:18415 EMAGE:18415
euxassay_014369_15 euxassay_014369_16 euxassay_014369_17 euxassay_014369_18 euxassay_014369_19
EMAGE:18415 EMAGE:18415 EMAGE:18415
euxassay_014369_20 euxassay_014369_21 euxassay_014369_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18415Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18415_wholemount_strong.wlz
18415_wholemount_moderate.wlz
18415_wholemount_weak.wlz
18415_wholemount_possible.wlz
18415_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18415_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 13 14 moderate expression: see section 15 16 17 18 19
radius
strong strong
regionalstrong expression: see section 01
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 02
humerus
strong strong
regionalstrong expression: see section 01 02 03 04
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 21
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 21
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 21
fibula
strong strong
regionalstrong expression: see section 02 03 moderate expression: see section 22
tibia
strong strong
regionalstrong expression: see section 01 02 03 moderate expression: see section 22
femur
strong strong
regionalstrong expression: see section 02 03 04 05 06 19 moderate expression: see section 07 08 09 20 21 22 weak expression: see section 18
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 weak expression: see section 15 16 17 18 19 20 21 22
spinal cord
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 weak expression: see section 15 16
otic capsule
strong strong
regionalstrong expression: see section 06 07 08 13 moderate expression: see section 14 15
nasal septum
strong strong
regionalstrong expression: see section 11
viscerocranium
strong strong
regionalExpression in the turbinate bone.
hyoid
moderate moderate
regionalmoderate expression: see section 17 18 19 weak expression: see section 16
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 12 13 14 moderate expression: see section 15 16 17 18 19 weak expression: see section 20
axial skeleton
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 moderate expression: see section 15
basioccipital bone
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 11 12 13 14 moderate expression: see section 10 16 17 18 19 20 21 22 weak expression: see section 15
basisphenoid bone
strong strong
regionalstrong expression: see section 07 08 09 11 12 13 moderate expression: see section 10
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 moderate expression: see section 16 17 18 19 20 21
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 05 06 07 moderate expression: see section 16 17 18 19 20 21 22
clavicle
strong strong
regionalstrong expression: see section 05 weak expression: see section 14
scapula
strong strong
regionalstrong expression: see section 02 03
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 10 moderate expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31849
Entity Detected:Brpf3, bromodomain and PHD finger containing, 3 ( MGI:2146836)
Sequence:sense strand is shown

>T31849
CATCGATCCCAAGATGCCCCGGGAGGGCCTCCTGCACAACGGTGTCCCCATCCCTGTCCCTCCACTGGAC
GTGCTGAAGCTGGGCGAGCAGAAGCAGGCAGAGGCTGGAGAGAGGCTCTTTCTTGTCCTCTTCTTTGACA
ACAAGAGGACCTGGCAGTGGCTTCCAAGGGACAAAGTCCTGCCCCTGGGTGTGGAGGACACTGTGGACAA
GCTCAAGATGCTAGAAGGCCGCAAGACCAGCATCCGGAAGTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6706331), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 61092. Forward Primer - name:061092_F_IRAW2_b09_Brpf3, sequence:CATCGATCCCAAGATGCC; Reverse Primer - name:061092_R_SP6_IRAW2_b09_Brpf3, sequence:TGACTTCCGGATGCTGGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18414 same embryo
 EMAGE:18417 same embryo
 EMAGE:18416 same embryo
 EMAGE:18413 same embryo
 EurExpress:euxassay_014369 same experiment
 MGI:4823506 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS