Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18720

Flnb filamin, beta ( MGI:2446089)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18720 EMAGE:18720 EMAGE:18720 EMAGE:18720 EMAGE:18720
"Pseudo-wholemount" of euxassay_014002. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014002_01 euxassay_014002_02 euxassay_014002_03 euxassay_014002_04
EMAGE:18720 EMAGE:18720 EMAGE:18720 EMAGE:18720 EMAGE:18720
euxassay_014002_05 euxassay_014002_06 euxassay_014002_07 euxassay_014002_08 euxassay_014002_09
EMAGE:18720 EMAGE:18720 EMAGE:18720 EMAGE:18720 EMAGE:18720
euxassay_014002_10 euxassay_014002_11 euxassay_014002_12 euxassay_014002_13 euxassay_014002_14
EMAGE:18720 EMAGE:18720 EMAGE:18720 EMAGE:18720 EMAGE:18720
euxassay_014002_15 euxassay_014002_16 euxassay_014002_17 euxassay_014002_18 euxassay_014002_19
EMAGE:18720 EMAGE:18720 EMAGE:18720 EMAGE:18720
euxassay_014002_20 euxassay_014002_21 euxassay_014002_22 euxassay_014002_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18720Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18720_wholemount_strong.wlz
18720_wholemount_moderate.wlz
18720_wholemount_weak.wlz
18720_wholemount_possible.wlz
18720_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18720_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 20 21 22 23
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 01 02 15
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 01 02 03 04 12 14
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 01 02 15 16
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 01 02 03 04 12 13 14
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 01 02 15 16
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 01 02 03 04 12 13 14
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 02 15 16
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 02 03 04 12 13 14
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 02
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 02 03 04 13 14
thymus primordium
moderate moderate
regionalmoderate expression: see section 15 16 17 weak expression: see section 12 13 14
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 09 17 18 19 20 weak expression: see section 08
vibrissa
moderate moderate
regionalmoderate expression: see section 02 weak expression: see section 03 04 17 18 19 20
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 12 13
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 11 12 13 14 15 16 17 18 19 20 21 22
otic capsule
moderate moderate
regionalmoderate expression: see section 18 19 20 weak expression: see section 06 07 08 09
nasal septum
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13
midgut
weak weak
regionalweak expression: see section 04 05 07 09
mandible
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21 22 23
lower jaw incisor
weak weak
regionalweak expression: see section 13
lower jaw molar
weak weak
regionalweak expression: see section 18
maxilla
weak weak
regionalweak expression: see section 03 04 05 06 07 17 19 20
palatal shelf
moderate moderate
regionalmoderate expression: see section 12
upper jaw incisor
weak weak
regionalweak expression: see section 13
upper jaw molar
weak weak
regionalweak expression: see section 18
thyroid cartilage
weak weak
regionalweak expression: see section 12 13 14 15
trachea
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 14 15
exoccipital bone
moderate moderate
regionalmoderate expression: see section 04 05 22
temporal bone
moderate moderate
regionalmoderate expression: see section 03 04 22 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 06
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 12 15 17
sternum
moderate moderate
regionalmoderate expression: see section 12 13
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 07 08 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39648
Entity Detected:Flnb, filamin, beta ( MGI:2446089)
Sequence:sense strand is shown

>T39648
AGAGATCAGCTGCATTGACAACAAAGACGGGACATGTACAGTGACCTACCTACCCACCTTGCCAGGGGAC
TACAGCATTCTGGTCAAGTACAATGACAAACATATTCCTGGCAGCCCCTTCACTGCCAAGATCACAGATG
ATAACAGACGCTGCTCCCAAGTGAAGCTGGGCTCAGCTGCTGACTTCCTTCTGGACATCAGTGAGACAGA
CCTTAGCACACTGACAGCCAGTATCAAGGCCCCATCTGGACGTGACGAGCCCTGTCTGCTAAAGAGGCTA
CCCAACAACCACATTGGCATTTCCTTCATCCCCCGAGAAGTGGGTGAGCATCTAGTCAGCATCAAGAAAA
ACGGTAACCACGTGGCCAACAGCCCTGTGTCCATTATGGTGGTCCAGTCTGAAATTGGTGATGCACGCCG
AGCCAAAGTCTATGGCCAAGGCCTGTCAGAAGGCCGGACTTTTGAGATGTCAGACTTCATCGTGGACACA
AGAGATGCAGAACTTCTCAGAGCCTTTTGCTTCCTCCTTTGCCACAAGCTCCGGAGCCAAGCTGGATATT
GTGTTGCAGGCTATGGTGGCATATCCTTGGCAGTAGAAGGACCCAGCAAGGTGGACATCCAAACAGAGGA
CCTGGAGGACGGCACCTGCAAGGTGTCCTACTTCCCCACTGTGCCCGGGGTCTATATCGTCTCCACCAAA
TTTGCTGACGAGCATGTGCCTGGAAGCCCATTCACTGTGAAGATCAGTGGCGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 84906. Forward Primer - name:084906_F_cDNA_Flnb, sequence:AGAGATCAGCTGCATTGACAAC; Reverse Primer - name:084906_N_SP6_cDNA_Flnb, sequence:CTCGCCACTGATCTTCACAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18722 same embryo
 EMAGE:18721 same embryo
 EMAGE:18719 same embryo
 EMAGE:18723 same embryo
 EMAGE:18718 same embryo
 EurExpress:euxassay_014002 same experiment
 MGI:4824877 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS