Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19012

Maf avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog ( MGI:96909)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19012 EMAGE:19012 EMAGE:19012 EMAGE:19012 EMAGE:19012
"Pseudo-wholemount" of euxassay_015869. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015869_01 euxassay_015869_02 euxassay_015869_03 euxassay_015869_04
EMAGE:19012 EMAGE:19012 EMAGE:19012 EMAGE:19012 EMAGE:19012
euxassay_015869_05 euxassay_015869_06 euxassay_015869_07 euxassay_015869_08 euxassay_015869_09
EMAGE:19012 EMAGE:19012 EMAGE:19012 EMAGE:19012 EMAGE:19012
euxassay_015869_10 euxassay_015869_11 euxassay_015869_12 euxassay_015869_13 euxassay_015869_14
EMAGE:19012 EMAGE:19012 EMAGE:19012 EMAGE:19012 EMAGE:19012
euxassay_015869_15 euxassay_015869_16 euxassay_015869_17 euxassay_015869_18 euxassay_015869_19
EMAGE:19012 EMAGE:19012 EMAGE:19012 EMAGE:19012 EMAGE:19012
euxassay_015869_20 euxassay_015869_21 euxassay_015869_22 euxassay_015869_23 euxassay_015869_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19012Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19012_wholemount_strong.wlz
19012_wholemount_moderate.wlz
19012_wholemount_weak.wlz
19012_wholemount_possible.wlz
19012_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19012_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 03 04 06 08 09 10 11 12 16 17 18 19 20 21
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 12 13 16 17
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 18 19 moderate expression: see section 11 14 15 17
pons mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 16 17
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 10 11 14 15 16 19 20 weak expression: see section 08
facial vii ganglion
strong strong
regionalstrong expression: see section 06 07 moderate expression: see section 21
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09 10 18 19 20 21 22 23
dorsal grey horn
strong strong
regionalstrong expression: see section 17 moderate expression: see section 10 11 12 13 14 15 16
lens
strong strong
regionalstrong expression: see section 02 moderate expression: see section 01 03
nasal septum
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17
mandible
weak weak
regionalweak expression: see section 04 05 06 07 22 23 24
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 12 16 17 18
lower jaw molar
weak weak
regionalweak expression: see section 19 20
maxilla
weak weak
regionalweak expression: see section 04 05 06 07 23 24
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 12 16 17 18
upper jaw molar
weak weak
regionalweak expression: see section 19 20 21
metanephros
weak weak
regionalweak expression: see section 08 09 10 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40542
Entity Detected:Maf, avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog ( MGI:96909)
Sequence:sense strand is shown

>T40542
CCCTCCTTCTGAGTTCTTCTGATTGAGCTTGCAAAGGAAAAAAAAATGTGAAATGCTATAGACCTTGCAG
CGAGCTGAGTTCCACGGGGGTTTTATCTTAGCATTGTTATGCTAAAACAGAATGAACTAAAGCCACTCCT
GAACCTGCCACAATCAAGCCTACATCAACCTTCTGGGTGTGACTTGTGAGTTTTGGCCTTATGATGCCAA
ATCTGAAAGTTTAGTCTGCCATTAAACAACAAACAAACAAAAACACAAAAACAAACTTACTCTCATCTCA
TGCATTACGATGCTTGCTACTTTGTCTTAGCAACAATGAACTATAACAGTTTCAAAGACATTATGGAAAA
GAGACATTATATTAATAAAAGAAGCCTGCATGCTGGACATGTATGGTATAATTATTTTTTTCCTTTTTTT
TCCCCCCAATTTGGCTTGGAAATGGACTTTTGAAGACTTAGCGCATGACATCCATACTTTTGATTTACAG
CCTCATGACTTTTTTGAGTTCCAAACAACAACAGAAAAAGTACAACCCCAGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 163097. Forward Primer - name:163097_F_cDNA_mCG146432, sequence:CCCTCCTTCTGAGTTCTTCTGA; Reverse Primer - name:163097_N_SP6_cDNA_mCG146432, sequence:CTCTGGGGTTGTACTTTTTCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19013 same embryo
 EMAGE:19008 same embryo
 EMAGE:19011 same embryo
 EMAGE:19009 same embryo
 EMAGE:19010 same embryo
 EurExpress:euxassay_015869 same experiment
 MGI:4826056 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS