Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19744

Rgs16 regulator of G-protein signaling 16 ( MGI:108407)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19744 EMAGE:19744 EMAGE:19744 EMAGE:19744 EMAGE:19744
"Pseudo-wholemount" of euxassay_006229. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006229_01 euxassay_006229_02 euxassay_006229_03 euxassay_006229_04
EMAGE:19744 EMAGE:19744 EMAGE:19744 EMAGE:19744 EMAGE:19744
euxassay_006229_05 euxassay_006229_06 euxassay_006229_07 euxassay_006229_08 euxassay_006229_09
EMAGE:19744 EMAGE:19744 EMAGE:19744 EMAGE:19744 EMAGE:19744
euxassay_006229_10 euxassay_006229_11 euxassay_006229_12 euxassay_006229_13 euxassay_006229_14
EMAGE:19744 EMAGE:19744 EMAGE:19744 EMAGE:19744 EMAGE:19744
euxassay_006229_15 euxassay_006229_16 euxassay_006229_17 euxassay_006229_18 euxassay_006229_19
EMAGE:19744 EMAGE:19744 EMAGE:19744
euxassay_006229_20 euxassay_006229_21 euxassay_006229_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19744Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19744_wholemount_strong.wlz
19744_wholemount_moderate.wlz
19744_wholemount_weak.wlz
19744_wholemount_possible.wlz
19744_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19744_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
moderate moderate
regionalmoderate expression: see section 16 17 18 19 20 21 weak expression: see section 01 02 03 04 05 06 07 08 09
hand mesenchyme
weak weak
regionalweak expression: see section 04 05 06 07
foot mesenchyme
weak weak
regionalweak expression: see section 04 05 06 19 20
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
thalamus mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 13 14 15 weak expression: see section 06 07 16 17
cerebral cortex marginal layer
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 21 22 moderate expression: see section 01 09 10 20 weak expression: see section 11 12 13 17 18 19
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 13 weak expression: see section 12
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 weak expression: see section 04 05
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 05
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17 weak expression: see section 14 15 18
lower lip
weak weak
regionalweak expression: see section 07 08 09 10 11
upper lip
weak weak
regionalweak expression: see section 07 08 09
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T583
Entity Detected:Rgs16, regulator of G-protein signaling 16 ( MGI:108407)
Sequence:sense strand is shown

>T583
CCTCGAGNCTGTTGGCCTACTGGGTGCCGCTCTCCAGACCTCTTCTGCGCAGCCTGGTACTTGCTACTCG
CTTTTCCCTCTTCGCCCTCCGGTCCGCCACCATCCTCTCCACGACGTGCTGTCCTGCGTCCGCAACCATG
TGCCGCACCCTAGCCACCTTCCCCAACACCTGCCTGGAGAGAGCCAAAGAGTTCAAGACGCGGCTGGGAA
TCTTTCTTCATAAATCAGAGCTGAGCTCCGATACTGGGGGTATTAGCAAATTCGAGTGGGCCAGTAAGCA
TAACAAAGAGAGAAGCTTCTCAGAAGATGTACTGGGATGGAGAGAGTCTTTCGATTTGCTGCTGAACAGT
AAAAATGGGGTGGCTGCCTTCCATGCCTTCCTAAAGACGGAATTCAGTGAGGAGAACCTGGAGTTCTGGT
TGGCCTGCGAGGAGTTCAAGAAGATCCGATCAGCCACCAAACTGGCGTCCAGGGCTCACCACATCTTTGA
CGAGTACATCCGCAGCGAAGCCCCTAAAGAGGTGAACATAGATCACGAGACCCGAGAA
Notes:The probe template was PCR amplified from IMAGE:1885381 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1885381 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19745 same embryo
 EMAGE:19748 same embryo
 EMAGE:19747 same embryo
 EMAGE:19746 same embryo
 EurExpress:euxassay_006229 same experiment
 MGI:4827718 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS