Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20058

Arhgap11a Rho GTPase activating protein 11A ( MGI:2444300)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20058 EMAGE:20058 EMAGE:20058 EMAGE:20058 EMAGE:20058
"Pseudo-wholemount" of euxassay_012266. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012266_01 euxassay_012266_02 euxassay_012266_03 euxassay_012266_04
EMAGE:20058 EMAGE:20058 EMAGE:20058 EMAGE:20058 EMAGE:20058
euxassay_012266_05 euxassay_012266_06 euxassay_012266_07 euxassay_012266_08 euxassay_012266_09
EMAGE:20058 EMAGE:20058 EMAGE:20058 EMAGE:20058 EMAGE:20058
euxassay_012266_10 euxassay_012266_11 euxassay_012266_12 euxassay_012266_13 euxassay_012266_14
EMAGE:20058 EMAGE:20058 EMAGE:20058 EMAGE:20058 EMAGE:20058
euxassay_012266_15 euxassay_012266_16 euxassay_012266_17 euxassay_012266_18 euxassay_012266_19
EMAGE:20058 EMAGE:20058 EMAGE:20058
euxassay_012266_20 euxassay_012266_21 euxassay_012266_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20058Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20058_wholemount_strong.wlz
20058_wholemount_moderate.wlz
20058_wholemount_weak.wlz
20058_wholemount_possible.wlz
20058_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20058_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 08 09 10 12
submandibular gland primordium
weak weak
regionalweak expression: see section 05 06 13 14 15
vibrissa
weak weak
regionalweak expression: see section 01 02 03 04 16 17 18 19
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12
diencephalon meninges
strong strong
regionalstrong expression: see section 06 09 10 11 moderate expression: see section 07 08 12 13 14 15
telencephalon mantle layer
moderate moderate
spottedmoderate expression: see section 02 03 04 05 06 07 08 09 10 12 13 15 16 weak expression: see section 17 18 19 20 21
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 07 08 09 10 11 16 17 18 19 20 21 22 moderate expression: see section 06 12 13 15
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 13 17 weak expression: see section 14
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 14 15 16 18 19 weak expression: see section 02 03 04 13 20 21
hindbrain meninges
strong strong
regionalstrong expression: see section 03 moderate expression: see section 04 05 06 07 08 14 16 17 18 19
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 16 18 weak expression: see section 14 15 17
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 03
midbrain meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 14 15 16 moderate expression: see section 05 06 12 13 17 18
midbrain ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 07 08 09 11 12 13
neural retina
strong strong
regionalstrong expression: see section 01 20 21 22
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 06 07 08 09 11 12 13 14 15
stomach
weak weak
regionalweak expression: see section 02 03 04 05 06 07
hindgut
weak weak
regionalweak expression: see section 11 12
midgut
weak weak
regionalweak expression: see section 05 07 11 12 14
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 07 08 10
lower jaw molar
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 04
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 07 08
upper jaw molar
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 04
metanephros
weak weak
regionalweak expression: see section 07 08 09 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30432
Entity Detected:Arhgap11a, Rho GTPase activating protein 11A ( MGI:2444300)
Sequence:sense strand is shown

>T30432
AAAGCGGGCTGCTTCTCTCCCAAAGTCAGTCGTAAAGAAAAGACCCGAAGATCTCTCCGTCTGAAATTTA
GTCTGGGGAAGAACAGAGATTCAGATGGATGTTCTGTCATCAATAGATATGAAAATGTTGGTCGACGACT
AGCGAATCAGCAAAATCTAAAAAGTAGGATTGATTCTGTAAAGACAGGCCTGCTTTTTAGCCCAGATATT
GATGAAAGATTGCTAAAGAAAGGCTCAGAAAAGATCAGCAAATCTGAGGAACACTTGTTAACTCCAGATC
AACTAGATGGAACAGGTTACCGGATGTCTTGGACAGAACCCAGTAATTCAAGTTTTCAAGACATGAGTGC
AAATGGAACTTCTCCAATAATGCAAAATCTTGAGGTGAAGAGCTTTTCTTTGGAGCCCGACATTACTGTT
GAAAAATCACCAGTTGTGTCCTGTGAGCTCAGGCCTTCCACCTTCCATAGCCAGCCTGACAGCAGTGTGC
TGTCTCTTAGTGGGGATGAAGGGAACCTGGCCTCCGAGACCTTGCAGAAGATTCAGAAAGCATTTTCCGA
ATCTGGGAGTGATCTTCATATGGTGATAAATCATGAGCAGTCATCAGTAACAAATACGGGGGAAGAAGTG
GAATTCAGAGATGTGACTGTGACTGAGTCAAAGGGACATGATGGGAGCTGTGCTGGGGAGGAGGAGAACT
GTCCTTCAGAACGGAATTTCTCACCGGATCAAAGCCCAGAGTTTGCCAGAGAAGCTGATGAGGAATGTTA
CTCAACTCAGATGAAGGTGGAATGTGAAGGCCTGCACTCAGAAACACCCAAAGCTGACCCCCTCATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6511064), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58658. Forward Primer - name:058658_F_IRAV105_b12_6530401L14Rik, sequence:AAAGCGGGCTGCTTCTCT; Reverse Primer - name:058658_R_SP6_IRAV105_b12_6530401L14Rik, sequence:GGATGAGGGGGTCAGCTT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20059 same embryo
 EMAGE:20057 same embryo
 EMAGE:20056 same embryo
 EMAGE:20055 same embryo
 EurExpress:euxassay_012266 same experiment
 MGI:4823215 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS