Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20066

Rcn2 reticulocalbin 2 ( MGI:1349765)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20066 EMAGE:20066 EMAGE:20066 EMAGE:20066 EMAGE:20066
"Pseudo-wholemount" of euxassay_012215. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012215_01 euxassay_012215_02 euxassay_012215_03 euxassay_012215_04
EMAGE:20066 EMAGE:20066 EMAGE:20066 EMAGE:20066 EMAGE:20066
euxassay_012215_05 euxassay_012215_06 euxassay_012215_07 euxassay_012215_08 euxassay_012215_09
EMAGE:20066 EMAGE:20066 EMAGE:20066 EMAGE:20066 EMAGE:20066
euxassay_012215_10 euxassay_012215_11 euxassay_012215_12 euxassay_012215_13 euxassay_012215_14
EMAGE:20066 EMAGE:20066 EMAGE:20066 EMAGE:20066 EMAGE:20066
euxassay_012215_15 euxassay_012215_16 euxassay_012215_17 euxassay_012215_18 euxassay_012215_19
EMAGE:20066 EMAGE:20066 EMAGE:20066 EMAGE:20066
euxassay_012215_20 euxassay_012215_21 euxassay_012215_22 euxassay_012215_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20066Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20066_wholemount_strong.wlz
20066_wholemount_moderate.wlz
20066_wholemount_weak.wlz
20066_wholemount_possible.wlz
20066_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20066_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 23 weak expression: see section 05 06 07 08 09 10 13 14 15 16 17 18 19 20 22
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 11 12 13
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 10 11 16 19 20 21 22 weak expression: see section 08 09 14 15 17 18
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 12 weak expression: see section 13 14 15 16 17
medullary raphe
moderate moderate
regionalmoderate expression: see section 11
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 18 19 20 21 weak expression: see section 04 07 08 09 10 11 13 14 15 16 17
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 weak expression: see section 07 08 14 15 16 17
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 weak expression: see section 17 18
otic capsule
weak weak
regionalweak expression: see section 07 08 16 17
thyroid cartilage
strong strong
regionalstrong expression: see section 12 weak expression: see section 10 11 13
axial skeleton
weak weak
regionalweak expression: see section 08 10 12 13 14 15 16
exoccipital bone
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 19 20 21 22 23
temporal bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 19 20 21 22 23
vault of skull
moderate moderate
regionalmoderate expression: see section 01 02
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 05 06 07 17 18 19 23
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36849
Entity Detected:Rcn2, reticulocalbin 2 ( MGI:1349765)
Sequence:sense strand is shown

>T36849
CAGGAAGACGTCGATGAGTATGTTAAACTTGGCCACGAAGAGCAGCAAAGACGATTGCAGTCGATCATAA
AGAAAATTGACTCGGACTCTGATGGCTTTCTTACTGAAAATGAACTCAGTCAGTGGATTCAGATGTCTTT
TAAGCATTACGCTATGCAAGAAGCCAAGCAGCAGTTTGTGGAGTATGATAAGAACAGCGACGGCGATCCT
GTGACGTGGGATGAGTACAACATCCAGATGTACGACCGGGTGATTGACTTTGATGAGAACACTGCTCTGG
ATGACACAGAAGAGGGGTCGTTCAGGCAGCTTCATCTAAAGGATAAGAAGCGATTTGAAAAAGCTAACCA
GGATTCAGGTCCTGGTCTGAGTCTTGAAGAGTTCATTGCGTTTGAGCACCCTGAAGAAGTTGACTATATG
ACGGAGTTCGTCATCCAAGAGGCTTTGGAAGAACATGACAAAAATGGCGATGGGTTTGTTAGTTTGGAAG
AATTTCTTGGCGATTACAGGCGGGATCCAACTGCAAATGAAGACCCAGAATGGATACTTGTTGAAAAGGA
CAGATTTGTGAATGATTATGACAAAGATAATGATGGCCGGCTTGATCCCCAAGAGCTGTTGTCATGGGTA
GTGCCCAATAACCAGGGCATTGCACAAGAGGAAGCTCTTCATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99699. Forward Primer - name:099699_F_cDNA_Rcn2, sequence:CAGGAAGACGTCGATGAGTATG; Reverse Primer - name:099699_N_SP6_cDNA_Rcn2, sequence:GATGAAGAGCTTCCTCTTGTGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20068 same embryo
 EMAGE:20067 same embryo
 EMAGE:20071 same embryo
 EMAGE:20070 same embryo
 EMAGE:20069 same embryo
 EurExpress:euxassay_012215 same experiment
 MGI:4827667 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS