Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20100

Scn3b sodium channel, voltage-gated, type III, beta ( MGI:1918882)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20100 EMAGE:20100 EMAGE:20100 EMAGE:20100 EMAGE:20100
"Pseudo-wholemount" of euxassay_012281. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012281_01 euxassay_012281_02 euxassay_012281_03 euxassay_012281_04
EMAGE:20100 EMAGE:20100 EMAGE:20100 EMAGE:20100 EMAGE:20100
euxassay_012281_05 euxassay_012281_06 euxassay_012281_07 euxassay_012281_08 euxassay_012281_09
EMAGE:20100 EMAGE:20100 EMAGE:20100 EMAGE:20100 EMAGE:20100
euxassay_012281_10 euxassay_012281_11 euxassay_012281_12 euxassay_012281_13 euxassay_012281_14
EMAGE:20100 EMAGE:20100 EMAGE:20100 EMAGE:20100 EMAGE:20100
euxassay_012281_15 euxassay_012281_16 euxassay_012281_17 euxassay_012281_18 euxassay_012281_19
EMAGE:20100 EMAGE:20100 EMAGE:20100 EMAGE:20100
euxassay_012281_20 euxassay_012281_21 euxassay_012281_22 euxassay_012281_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20100Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20100_wholemount_strong.wlz
20100_wholemount_moderate.wlz
20100_wholemount_weak.wlz
20100_wholemount_possible.wlz
20100_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20100_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 05 21 23 moderate expression: see section 03 04 19 20 22
upper leg muscle
strong strong
regionalstrong expression: see section 05 moderate expression: see section 03 04 19 20 21 22 23
diaphragm
strong strong
regionalstrong expression: see section 03 04 moderate expression: see section 02 05 15 16 17 18 19 weak expression: see section 06 07 14
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 05 06 07 08 21 22 23 moderate expression: see section 04 09 10 11 12 14 15 16 17 18 19 20
hypothalamus mantle layer
strong strong
homogeneousstrong expression: see section 09 10 11 13 14 15 16
diencephalon lateral wall mantle layer
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
telencephalon marginal layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 12 13 14 15 16 17 18
olfactory cortex marginal layer
strong strong
homogeneousstrong expression: see section 07 08 09 12 13 14
medulla oblongata basal plate mantle layer
strong strong
homogeneousstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
rest of cerebellum mantle layer
strong strong
homogeneousstrong expression: see section 07 08 09 10 14 15 16 17 18 moderate expression: see section 05 06 19 20 21
pons mantle layer
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
midbrain mantle layer
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 moderate expression: see section 19 20
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 16 17 18 19 20 21
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 07 17 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 15
spinal cord mantle layer
strong strong
homogeneousstrong expression: see section 10 11 12 13 14 15 16 17
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 09 10 14 15
cervical ganglion
strong strong
regionalstrong expression: see section 09 17
thoracic ganglion
strong strong
regionalstrong expression: see section 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 15 16 17 weak expression: see section 18
neural retina
strong strong
regionalstrong expression: see section 01 02 21 22 moderate expression: see section 20 weak expression: see section 23
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 13 14 15 16
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 09
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08
midgut
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30384
Entity Detected:Scn3b, sodium channel, voltage-gated, type III, beta ( MGI:1918882)
Sequence:sense strand is shown

>T30384
AAGGCCTGGAACAAACCCAGAACTTCCAAGAAGCCAAGGAAGCATCCAGGACGATTTCAGTAGGTTTTGA
AAGCGATATAACACTCCCGAGATTGGAAACACGGATGAGTGAATTTTCTGGGTTGAAATGCCTCACTTCT
TCATTTCTCAGTGTCTGTGGATCAGTATTAGTCCTCGTTTTACAGGAGGCATCTGAGACTCACACAAGGC
TGAACAGGATATTGAGGGGATTAAACTGGCCGAGAGATGAGTTTCATGCCTCCACTCTTACACTCCCTAA
GCTGAAAGATGTTTTTGAGGACTCTTAACAATCAGCAGGGCAGAAGCATGGCATTTGTCCAGCAGAGGCT
ACAGGTGACATGAGACAGACTTTAGGATTTCACACAAAGATTTGTGAATCTGAAGCATCCTCCAAGAGAC
ATGGCACCTGAGGGCAATAGCTATATGGCAAAAAATGTTTTTAGTCTGAAATGGACAATGAACAAAGAGA
CAAAGATAGGTGTGTAGCTTCTAAATACCTCACCTGTAGATGTCATGTTTGGGTATTGGTGTTTGTAAAG
TCCCCCACCCCTACCCTCATCCCCACCCAAGAGAGCAGGGAACAAGTGACAAGATTCTTAGTCAATATCT
CTTTTTTAATGACTGTTCTAAGTGCAATATTCTTTAGCCCCTACAGATAGCAAGGGCAGGAGGCCTTATG
GTATATAAAAAGATGCAAGTGAGACTCAGTAAGAGAGTTGTCCTCACTCTGAGGAGCTCTATAAGAAAGA
CCCTTCTCCACCCCCATCGGGCTTTGTATGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6308278), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58317. Forward Primer - name:058317_F_IRAV102_d03_Scn3b, sequence:AAGGCCTGGAACAAACCC; Reverse Primer - name:058317_R_SP6_IRAV102_d03_Scn3b, sequence:GCCATACAAAGCCCGATG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20097 same embryo
 EMAGE:20098 same embryo
 EMAGE:20099 same embryo
 EMAGE:20101 same embryo
 EurExpress:euxassay_012281 same experiment
 MGI:4827903 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS