Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20161

Fibin fin bud initiation factor homolog (zebrafish) ( MGI:1914856)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20161 EMAGE:20161 EMAGE:20161 EMAGE:20161 EMAGE:20161
"Pseudo-wholemount" of euxassay_012586. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012586_01 euxassay_012586_02 euxassay_012586_03 euxassay_012586_04
EMAGE:20161 EMAGE:20161 EMAGE:20161 EMAGE:20161 EMAGE:20161
euxassay_012586_05 euxassay_012586_06 euxassay_012586_07 euxassay_012586_08 euxassay_012586_09
EMAGE:20161 EMAGE:20161 EMAGE:20161 EMAGE:20161 EMAGE:20161
euxassay_012586_10 euxassay_012586_11 euxassay_012586_12 euxassay_012586_13 euxassay_012586_14
EMAGE:20161 EMAGE:20161 EMAGE:20161 EMAGE:20161 EMAGE:20161
euxassay_012586_15 euxassay_012586_16 euxassay_012586_17 euxassay_012586_18 euxassay_012586_19
EMAGE:20161 EMAGE:20161 EMAGE:20161 EMAGE:20161 EMAGE:20161
euxassay_012586_20 euxassay_012586_21 euxassay_012586_22 euxassay_012586_23 euxassay_012586_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20161Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20161_wholemount_strong.wlz
20161_wholemount_moderate.wlz
20161_wholemount_weak.wlz
20161_wholemount_possible.wlz
20161_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20161_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diaphragm
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 weak expression: see section 17 18
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 20 21 22 23
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 20 21 22 23
forelimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 23
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 03 04 weak expression: see section 16
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 18 19
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 03 04 17 18
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 18 19
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 03 04 17
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 18 19
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 03 04 weak expression: see section 16
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 02
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 03 04
tarsus
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 19 20
anterior abdominal wall musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 18 19 20 21 22 23 24
cranial musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 21 22 23 24
vibrissa
weak weak
regionalweak expression: see section 03 04 22
extrinsic ocular muscle
weak weak
regionalweak expression: see section 01 02 03 21 22 23
naris
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
tongue
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
lower lip
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
upper lip
strong strong
regionalstrong expression: see section 06 07 08 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 09 10
palatal shelf
strong strong
regionalstrong expression: see section 11 12 13 14 15
trachea
strong strong
regionalstrong expression: see section 13 14 15
axial skeleton cervical region
moderate moderate
regionalmoderate expression: see section 09
axial skeleton lumbar region
moderate moderate
regionalmoderate expression: see section 08 11 12 13
axial skeleton sacral region
moderate moderate
regionalmoderate expression: see section 08 10 11 12
axial skeleton thoracic region
moderate moderate
regionalmoderate expression: see section 13 15 16
sternum
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
tail mesenchyme
strong strong
regionalstrong expression: see section 08 09 12 moderate expression: see section 10 11
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31294
Entity Detected:Fibin, fin bud initiation factor homolog (zebrafish) ( MGI:1914856)
Sequence:sense strand is shown

>T31294
TCAGGGTGAGTGATCGCAGGCGCTGCTCCCAGGGGGAAGGGGGCCAAGCCAGTAGCTTGCTGAGCCTCAC
TCTTCGAGAGGAGTTCACAGTACTGGGCCGCCAGGTGGAGGATGCTGGACGCGTCCTGGAGGGCATCAGC
AAGAGCATCTCCTACGACCTGGATGGGGAAGAGAGTTATGGCAAGTACCTGAGGCGGGAGTCCCACCAGA
TCGGGGATGCCTACTCCAACTCTGACAAGTCCCTCACTGAGCTGGAAAGCAAGTTCAAGCAGGGCCAAGA
GCAGGATAGCCGGCAGGAAAGCAGACTCAATGAGGACTTCCTGGGGATGCTGGTCCACACCAGGTCCTTG
CTGAAGGAGACACTGGACATCTCTGTGGGGCTCAGAGACAAATACGAGCTGCTGGCACATACCATCAGGA
GCCATGGGACCCGCTTAGGTCGACTGAAAAGCGACTATCTGGAGGGTGGGGCACAGAAGACAGGCTAATA
TTTCCATTGTAACTGCTTTATTTTATCCAAATTTGCACTTTCAGAACACGTCTGAAGTCATCTTTCGAAA
AGAAAGAAAAATTTTAATAAGTTGAGTTATTCTGATTTTAGTTTGGTTTTGTGCATTATTTATGTTATTA
TTAAGGATTTTTCACTTGCAAAAAAAAGCAATTTTAAACTAACCCCTGGGTTATTTCCTAAAGGGTTTTA
TTGCTCTAACAGAATCTCTTCTTTCGACTCCATCTAAAGGATGCATTTGTGTGGAAAGACTGATTAAACT
TCCACATCCTGGCGGGGGACGAGGTGCGTGGCTCCTTTGCATCAGCAGGCTTCTCTTTGGTCTCTGAAGG
CTGAGATGCCTGATTTTCAGATGAGGTCCCAGGTGTGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3603588), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 23945. Forward Primer - name:023945_F_IRAV51-54_B03_1110018M03Rik, sequence:TCAGGGTGAGTGATCGCA; Reverse Primer - name:023945_R_SP6_IRAV51-54_B03_1110018M03Rik, sequence:CCACACACCTGGGACCTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20164 same embryo
 EMAGE:20160 same embryo
 EMAGE:20163 same embryo
 EMAGE:20162 same embryo
 EMAGE:20165 same embryo
 EurExpress:euxassay_012586 same experiment
 MGI:4824861 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS